Journal of Clinical & Experimental Dermatology Research

Journal of Clinical & Experimental Dermatology Research
Open Access

ISSN: 2155-9554

Research Article - (2011) Volume 2, Issue 8

Superantigen Profile of Staphylococcus Aureus Isolates from Patients with Atopic Dermatitis in Sri Lanka

Gomes PLR1, Gathsaurie Neelika Malavige1,2, Fernando N1, Mahendra MHR1, Seneviratne JKK3 and Graham S Ogg2,4*
1Department of Microbiology, University of Sri Jayawardanapura, Sri Lanka
2MRC Human Immunology Unit, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford Radcliffe Trust, Oxford, UK
3Dermtology Clinic, Lady Ridgeway Hospital for Children, Sri Lanka
4Department of Dermatology, Churchill Hospital, Oxford Radcliffe Trust, Oxford, UK
*Corresponding Author: Dr. Graham S Ogg, DPhil FRCP, Cutaneous Immunology Group, Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, UK, Tel: (0) 1865 222334, Fax: (0) 1865 222502 Email:

Abstract

Background:Staphylococcus aureus colonizes most patients with atopic dermatitis. Staphylococcus aureus is able to produce staphylococcal enterotoxins, staphylococcal enterotoxin-like toxins and Toxic shock syndrome toxin – 1.The presence of superantigen encoding genes has been associated with atopic dermatitis in other cohorts.

Aim: To determine the association of different Staphylococcal superantigens with clinical disease severity in a tropical disease setting in patients with atopic dermatitis.

Methodology: Skin swabs collected from 100 patients with atopic dermatitis and 120 controls were cultured. Severity of atopic dermatitis was graded using the Nottingham Eczema Severity Score. Bacterial DNA was extracted and superantigen genes were detected by separate PCRs.

Results:52/59 (88%) of Staphylococcus aureus isolates from patients and 5/16 (31%) from healthy individuals had genes encoding at least one type of superantigen. Each superantigen type was expressed significantly higher (P<0.05) in patients than in healthy individuals. Possession of genes for staphylococcal enterotoxin-like toxin type M (P=0.038) and staphylococcal enterotoxin-like toxin type O (P=0.016) were associated with milder disease. Possession of staphylococcal enterotoxin type B gene was significantly higher (p=0.0186) in Staphylococcus aureus isolated from patients who were aged 5 years or older compared to Staphylococcus aureus isolated from younger patients. Strains possessing genes that encode the classical superantigens such as staphylococcal enterotoxin type A, B, C, E and Toxic shock syndrome toxin – 1 were significantly associated with patients with moderate to severe disease when they possessed not more than two superantigen genes in total.

Conclusions: Superantigens associate with atopic dermatitis in a cohort of patients from Sri Lanka consistent with a role in disease pathogenesis. Differences in superantigen gene possession are unlikely to explain differences in disease prevalence between populations from tropical and temperate climates.

<

Keywords: Atopic dermatitis; Superantigens; Clinical diseases severity; Staphylococcus aureus

Abbreviations

AD: Atopic Dermatitis; SA: Staphylococcus aureus; SAgs: Superantigens; Th: Helper T cell; SEs: Staphylococcal Enterotoxins; SEls: Staphylococcal Enterotoxin-like Toxins; TSST-1: Toxic Shock Syndrome Toxin – 1; egc: enterotoxin gene cluster

Introduction

Atopic dermatitis (AD) is a chronic relapsing, itchy, inflammatory condition of the skin. It is one of the commonest skin diseases affecting around 10% to 30% of children and 2-3% of adults [1-3]. Studies have shown that superantigen producing strains of Staphylococcus aureus (SA) could be isolated from over 70% of patients with AD [4-6]; Superantigens (SAgs) of SA have been shown to play an important role in inducing skin inflammation in AD. They are thought to aggravate the disease by multiple pathways including activation of T cells that are important in the disease pathogenesis of AD. SAgs have shown to induce expansion of allergen specific Th2 cells [7], and stimulate the production of proinflammatory cytokines by T cells [8]. They also increase presentation of allergens such as house dust mite by keratinocytes [7] and have also shown to reduce activity of regulatory T cells [9,10].

Staphylococcal superantigens include staphylococcal enterotoxins (SEs), staphylococcal enterotoxin-like toxins (SEls) and Toxic shock syndrome toxin – 1 (TSST-1). SEs and SEls are a broad family of pyrogenic toxin superantigens [11]. Those that induce vomiting are designated as SEs and the related toxins that lack emetic activity or have not been tested for it are designated as SEls [12]. These include the SEs: SEA-E, SEG-I, SER-T and the SEls: SElJ-Q, SElU, SElU2, and SelV [13]. SA strains producing SAgs encoded by the enterotoxin gene cluster (SEG, SEI, SElM, SElN, SElO) are commonly isolated from patients with AD [4,14]. Although high percentages of SAg producing SA strains have been isolated from patients with AD, a significant association of any particular SAg with clinical disease severity has not been observed [4,5,14,15]. However, sensitization to staphylococcal superantigens has found to be associated with higher disease severity [16,17].

Although the association of SAgs and AD is well established, the association in tropical climates is not known. Differential superantigen expression between populations is clearly of interest in order to determine the potential relative roles in disease; an absence of SAg expression in isolates from patients living in tropical climates would potentially argue against their role in disease pathogenesis. Therefore we have investigated the SAg profile of SA isolates from patients with AD in Sri Lanka.

Materials and Methods

Participants

A total of 100 patients with AD (40 male, 60 female patients; mean age 6 ± SD 9.6 years, range 0.1– 46.8) were recruited from a tertiary care hospital in Sri Lanka. The study was approved by the local ethics committee, and all participants gave informed written consent. AD was defined according to the U.K. Working Party’s Diagnostic Criteria [18] and severity was graded according to the Nottingham Eczema Severity Score : preliminary refinement of the Rajka and Langeland grading’ by a dermatologist [19]. The patient group included 61 (61%) patients with mild AD, 30 (30%) patients with moderate AD and 9 (9%) patients with severe AD. The control group comprised of 120 (60 male, 60 female patients; mean ± SD age 14.9 ± 12.3 years, range 0.7–47) agematched individuals (healthy volunteers) who did not have any history of asthma, AD or allergic rhinitis.

Isolation of Staphylococcus aureus

Skin swabs were collected from eczematous lesions and nonlesional areas from patients with AD (swabs from two lesions and two nonlesional areas) and also from healthy individuals (from left and right antecubital fossae). Swabs were inoculated onto mannitol salt agar (Hi-Media Laboratories, Mumbai, India) and SA was identified after overnight incubation at 37ºC.

Bacterial DNA extraction and PCR for superantigen toxin genes

Bacterial DNA extracted using the DNeasy blood and tissue kit (Qiagen®) according to the manufacturer’s instructions. The presence of genes encoding TSST-1, SEA-E, SEG-I and SElJ-Q were detected for all the isolates by separate PCRs for each superantigen using the primer sets described previously [20,21] (Table 1). PCR products were separated on 1% w/v agarose (Promega) in 1*TAE buffer and visualized under a UV transmitter (Fotodyne™).

Superantigenic toxin type Sequence (5' to 3') for Forward/Reverse primers Ta/°C product size
SEA GCAGGGAACAGCTTTAGGC GTTCTGTAGAAGTATGAAACACG 53 521bp
SEB GTATGATGATAATCATGTATCAGCAATA CGTAAGATAAACTTCAATCTTCACATC 53 625bp
SEC GAGTCAACCAGACCCTATGCC CGCCTGGTGCAGGCATC 55 614bp
SED GAGACTAGCCGCAATCTATCC GCTGCATTTAGTAATGCTGGCTG 54 650bp
SEE GGTAGCGAGAAAAGCGAAG GCCTTGCCTGAAGATCTAGCTC 54 450bp
SEG TGAATGCTCAACCCGATCCTAAAT CAAACCAAAAACTTGTATTGTTCTTTTCA 54 580bp
SEH TTCACATCATATGCGAAAGCAGAA CAGATTTTAAAGTTTTATTGTCTTCA 50 625bp
SEI CGTATGCTCAAGGTGATATTGGTG AAAAACTTACAGGCAGTCCATCTCC 55 580bp
SElJ TTTAGGATCCCTACAGAACCAAAGG GTTTCCATGGATAGCAAAAATGAAAC 50 750bp
SElK GTGTCTCTAATAATGCCAGCGCTC TTTGGTAGCCCATCATCTCC 55 650bp
SElL CACCAGAATCACACCGCTTA TCCCCTTATCAAAACCGCTAT 51 450bp
SElM TTTTGCTATTCGCAAAATCATATCGCA TCAACTTTCGTCCTTATAAGATATTTCTAC 54 687bp
SElN TGAGATTGTTCTACATAGCTGCAA AATTAGATGAGCTAACTGTTCTATTATCAC 54 720bp
SElO TAGTGTAAACAATGCATATGCAAATG ATTATGTAAATAAATAAACATCAATATGATA 50 721bp
SElP GGAAGCTAAAGCAGAGACAC CCCGTTTCATATGAAGTGCCACC 51 660bp
SElQ GCTTCAAGGAGTTAGTTCTGG CTCTCTGCTTGACCAGTTCCGGTG 57 510bp
TSST-1 GAAATTTTTCATCGTAAGCCCTTTGTTG TTCATCAATATTTATAGGTGGTTTTTCA 53 625bp

Table 1: Base sequences, annealing temperature selected for the primer set (Ta), and product size of amplified products and the control for the superantigen primer sets.

Statistical analysis

Data analysis was carried out using GraphPad Prism 4. Fisher’s exact test was used to calculate statistical significance. A “P” value < 0.05 was considered significant.

Results

SAg expression in AD patients and in healthy individuals

The total numbers of patients with SA isolated was 59/100 (59%) compared to the number of controls 16/120 (13.3%). Skin colonization was seen in 57 (57%) patients compared to 10 (8%) controls and nasal colonization of SA was seen in 45 (45%) patients and in 9 (8%) controls. Two patients had nasal colonization only. 52/59 (88%) of SA isolates from patients and 5/16 (31%) from healthy individuals had genes encoding at least 1 type of SAg gene. The frequencies of each of these SAgs in SA colonized patients with varying severity are shown in Table 2. Each type of SAg gene was present in significantly higher numbers of patients when compared to healthy individuals with the exception of SElL (P=0.14) and SEH (not found). The presence of genes encoding SElM (P=0.038) and SElO (P=0.016) were associated with milder disease but this was not significant after correction for multiple comparisons.

Superantigenic toxin type No of isolates from Odds ratio 95% Confidence interval P value (fisher exact test) P C
patients with mild AD (total n=28) n/(%) patients with moderate to severe AD (total n=31) n/(%)
SEA 05 (17.8) 10 (32) 2.19 0.7026 to 4.645 0.24 4.13
SEB 04 (14.3) 4 (12.9) 0.89 0.2490 to 3.277 1.00 17.00
SEC 07 (25.0) 8 (25.8) 1.04   1.00 17.00
SED 05 (17.9) 4 (12.9) 0.68 0.1634 to 2.842 0.72 12.29
SEE 04 (14.3) 5 (16.1) 1.15 0.3361 to 3.793 1.00 17.00
SEG 13 (46.4) 10 (32.3) 0.55 0.3638 to 1.327 0.29 5.04
SEH 00 (0) 00 (0)       0.00
SEI 13 (46.4) 13 (41.9) 0.83 0.5085 to 1.604 0.79 13.53
SEJ 02 (7.1) 3 (9.7) 1.39   1.00 17.00
SElK 03 (10.7) 4 (12.9) 1.23   1.00 17.00
SElL 01 (3.6) 5 (16.1) 5.40   0.20 3.36
SElM 17 (60.7) 10 (32.3) 0.31 0.2943 to 0.9593 0.04 0.65
SElN 12 (42.9) 9 (29) 0.55 0.3373 to 1.360 0.30 4.95
SElO 14 (50) 6 (19.4) 0.24 0.1724 to 0.8689 0.01 0.27
SElP 05 (17.9) 4 (12.9) 0.68   0.72 12.29
SElQ 03 (10.7) 4 (12.9) 1.39   1.00 17.00
TSST-1 06 (21.4) 6 (19.4) 0.88   1.00 17.00

Table 2: Association of superantigen production with severity of atopic dermatitis (AD).

Colonization with SA strains possessing genes for SAg subtypes in patients with varying clinical disease severity

In addition, the involvement of the body surface area showed a trend towards being less in patients colonized with SElO (p=0.24, OR, 0.4802, CI = 0.3122 to 1.258). SEO gene possessing SA strains were found in 9 (45%) of patients who scored less than 3 points in the body surface area affected, whereas SEO was seen in 11 (28%) of patients who scored >3 points. Although not statistically significant, patients colonized with SEA gene possessing SA strains showed higher risk of developing moderate to severe AD (P = 0.2432, OR = 2.19, CI = 0.7026 to 4.645). None of the SAgs was significantly higher in AD with other atopic diseases such as asthma, allergic rhinitis and food allergies (P>0.05) when compared to AD patients who did not have other atopic diseases. Further SAgs were not significantly associated with duration of AD lesions, body surface area affected or sex of patients.

Possession of SEB gene was significantly higher (P=0.019) from SA isolated of patients who were aged 5 years or older compared to SA isolated of younger patients. Although not statistically significant, genes encoding SEC and SEE were also found at a higher frequency in patients aged 5 years or older compared to patients who were younger. When SEB, SEC and SEE were grouped together, SA isolates from patients 5 years or older produced at least one type of these SE when compared to younger patients, which was statistically significant (P=0.0001).

Multiple SAg gene possession and disease severity

SA was isolated from 28 (46%) patients with mild AD and 25 (89%) isolates had genes encoding the SAgs. Out of 31 SA isolates from patients with moderate to severe AD 27 (87%) were positive for SAg genes. Strains possessing genes that encode the classical superantigens such as SEA, SEB, SEC, SEE and TSST were significantly associated with patients with moderate to severe disease when they possessed not more than 2 SAg genes in total. Such SA strains comprised 12 out of 27 (44%) of SAg gene positive strains isolated from patients with moderate to severe AD when compared to 3/25 (12%) of SAg gene positive strains from patients with mild AD (P= 0.014).

Discussion

Our data show that SAg gene positive SA strains are expressed at a high frequency in patients with AD. Each SAg type was found at a significantly higher frequency (P<0.05) in patients with AD than in healthy individuals colonized with SA, with the exception of SElL and SEH. Our results indicate that a very high percentage (88%) of SA strains isolated from patients with AD is positive for genes that encode SAgs, which supports their role in the pathogenesis of AD. This high percentage is compatible with the findings from previous studies from other cohorts where 70 –100% of strains isolated were positive for SAg genes [4-6,22].

Our previous studies have shown that SA skin colonisation rates (57%) were comparatively lower in AD patients in Sri Lanka when compared to SA colonisation rates of patients from European countries, United States [23] and some Asian countries [15]. In these countries the SA colonization rates were between 80% - 100% [24,25]. However, SA colonisation rates in healthy Sri Lankan individuals (13%) were comparable to the rates reported in healthy European individuals (6- 30%) [26]. Although, SA colonization rates were lower in AD patients in Sri Lanka, the presence of genes encoding SAg in SA isolates were similar to those from countries with a high prevalence. Therefore, differential superantigen gene possession cannot explain differences in disease prevalence between populations from tropical and temperate climates.

Out of the superantigens SElM, (46%), SEI (44%), SEG (39%), SElN (36%) and SElO (34%) were the most abundant. All these genes are located on an accessory genetic element known as the enterotoxin gene cluster (egc) [13]. These SAgs have also been shown to be the most frequent enterotoxins (37-48%) produced by SA colonising patients with AD [4,14]. egc-genes have found to be the most prevalent SAg genes in commensal and invasive SA isolates with reported frequencies between 52 and 66% [27-29]. However these studies have not found these egc coded SAgs to be significantly associated with clinical disease severity.

Although a significantly positive relationship was not observed between any individual SAg and disease severity, the presence of genes encoding SElM (P=0.0380) and SElO (P=0.0158) showed a trend towards being associated with milder disease. SElM and SElO are found to induce 21.3 and 7.1 subpopulations of Vβ T cells respectively [30]. These two subpopulations are not induced by the majority of other SAg types or induced comparatively weakly [30]. These two subpopulations of Vβ T cells may have a modified response when induced. We did not find any significant association with any of the SAgs with duration of AD lesions, body surface area affected or sex of patients. The presence of SAg genes was also not significantly higher in patients with AD with other atopic diseases such as asthma, allergic rhinitis and food allergies than those with AD alone. However, possession of genes encoding SEB alone and a SAg group including SEB, SEC and SEE were seen at a higher frequency in patients 5 years or older (P<0.05).

Several recent studies have not observed a significant association of any particular SAg with clinical disease severity of AD [4,5,14,15]. Yet these studies have also shown high percentages of SAg gene positive SA in patients with AD. Other studies have found allergic sensitization to staphylococcal superantigens to be associated with higher disease severity [16,17]. Therefore, it will be important to investigate sensitization and Vβ T cell expansion studies in SA colonized patients with AD in Sri Lanka.

Overall these data show in a population of individuals in Sri Lanka, that proportional superantigen gene possession associates with the presence of AD, and confirms the findings observed in cohorts from temperate climates. This would support a role of superantigen expressing SA in the pathogenesis of AD and suggests that differential superantigen gene possession cannot explain differences in disease prevalence between populations from tropical and temperate climates.

Acknowledgement

Funding was provided by the Medical Research Council (UK) and a research grant from the University of Sri Jayawardanapura, Sri Lanka (ASP/06/RE/2009/09). The funders had no role in study design, data collection and analysis, decision to publish, or in the preparation of the manuscript.

References

  1. Sturgill S, Bernard LA (2004) Atopic dermatitis update. Curr Opin Pediatr 16: 396-401.
  2. Hanifin JM, Reed ML (2007) A population-based survey of eczema prevalence in the United States. Dermatitis 18: 82-91.
  3. Mempel M, Lina G, Hojka M, Schnopp C, Seidl HP, et al. (2003) High prevalence of superantigens associated with the egc locus in Staphylococcus aureus isolates from patients with atopic eczema. Eur J Clin Microbiol Infect Dis 22: 306-309.
  4. Kim DW, Park JY, Park KD, Kim TH, Lee WJ, et al. (2009) Are there predominant strains and toxins of Staphylococcus aureus in atopic dermatitis patients? Genotypic characterization and toxin determination of S. aureus isolated in adolescent and adult patients with atopic dermatitis. J Dermatol 36: 75-81.
  5. Yagi S, Wakaki N, Ikeda N, Takagi Y, Uchida H, et al. (2004) Presence of staphylococcal exfoliative toxin A in sera of patients with atopic dermatitis. Clin Exp Allergy 34: 984-993.
  6. Ardern-Jones MR, Black AP, Bateman EA, Ogg GS (2007) Bacterial superantigen facilitates epithelial presentation of allergen to T helper 2 cells. Proc Natl Acad Sci U S A 104: 5557-5562.
  7. Baker BS (2006) The role of microorganisms in atopic dermatitis. Clin Exp Immunol 144: 1-9.
  8. Cardona ID, Goleva E, Ou LS, Leung DY (2006) Staphylococcal enterotoxin B inhibits regulatory T cells by inducing glucocorticoid-induced TNF receptor-related protein ligand on monocytes. J Allergy Clin Immunol 117: 688-695.
  9. Goleva E, Cardona ID, Ou LS, Leung DY (2005) Factors that regulate naturally occurring T regulatory cell-mediated suppression. J Allergy Clin Immunol 116: 1094-1100.
  10. Balaban N, Rasooly A (2000) Staphylococcal enterotoxins. Int J Food Microbiol 61: 1-10.
  11. Lina G, Bohach GA, Nair SP, Hiramatsu K, Jouvin-Marche E, et al. (2004) Standard nomenclature for the superantigens expressed by Staphylococcus. J Infect Dis 189: 2334-2336.
  12. Thomas DY, Jarraud S, Lemercier B, Cozon G, Echasserieau K, et al. (2006) Staphylococcal enterotoxin-like toxins U2 and V, two new staphylococcal superantigens arising from recombination within the enterotoxin gene cluster. Infect Immun 74: 4724-4734.
  13. Bonness S, Szekat C, Novak N, Bierbaum G (2008) Pulsed-field gel electrophoresis of Staphylococcus aureus isolates from atopic patients revealing presence of similar strains in isolates from children and their parents. J Clin Microbiol 46: 456-461.
  14. Chiu LS, Ho MS, Hsu LY, Tang MB (2009) Prevalence and molecular characteristics of Staphylococcus aureus isolates colonizing patients with atopic dermatitis and their close contacts in Singapore. Br J Dermatol 160: 965-971.
  15. Ong PY, Patel M, Ferdman RM, Dunaway T, Church JA (2008) Association of staphylococcal superantigen-specific immunoglobulin e with mild and moderate atopic dermatitis. J Pediatr 153: 803-806.
  16. Zollner TM, Wichelhaus TA, Hartung A, Von Mallinckrodt C, Wagner TO, et al. (2000) Colonization with superantigen-producing Staphylococcus aureus is associated with increased severity of atopic dermatitis. Clin Exp Allergy 30: 994-1000.
  17. Williams HC, Burney PG, Pembroke AC, Hay RJ (1994) The U.K. Working Party's Diagnostic Criteria for Atopic Dermatitis. III. Independent hospital validation. Br J Dermatol 131: 406-416.
  18. Emerson RM, Charman CR, Williams HC (2000) The Nottingham Eczema Severity Score: preliminary refinement of the Rajka and Langeland grading. Br J Dermatol 142: 288-297.
  19. Lovseth A, Loncarevic S, Berdal KG (2004) Modified multiplex PCR method for detection of pyrogenic exotoxin genes in staphylococcal isolates. J Clin Microbiol 42: 3869-3872.
  20. Schlievert PM, Case LC, Strandberg KL, Tripp TJ, Lin YC, et al. (2007) Vaginal Staphylococcus aureus superantigen profile shift from 1980 and 1981 to 2003, 2004, and 2005. J Clin Microbiol 45: 2704-2707.
  21. Schlievert PM, Case LC, Strandberg KL, Abrams BB, Leung DY (2008) Superantigen profile of Staphylococcus aureus isolates from patients with steroid-resistant atopic dermatitis. Clin Infect Dis 46: 1562-1567.
  22. Suh L, Coffin S, Leckerman KH, Gelfand JM, Honig PJ, et al. (2008) Methicillin-resistant Staphylococcus aureus colonization in children with atopic dermatitis. Pediatr Dermatol 25: 528-534.
  23. Gilani SJ, Gonzalez M, Hussain I, Finlay AY, Patel GK (2005) Staphylococcus aureus re-colonization in atopic dermatitis: beyond the skin. Clin Exp Dermatol 30: 10-13.
  24. Guzik TJ, Bzowska M, Kasprowicz A, Czerniawska-Mysik G, Wojcik K, et al. (2005) Persistent skin colonization with Staphylococcus aureus in atopic dermatitis: relationship to clinical and immunological parameters. Clin Exp Allergy 35: 448-455.
  25. Haslund P, Bangsgaard N, Jarlov JO, Skov L, Skov R, et al. (2005) Staphylococcus aureus and hand eczema severity. Br J Dermatol 161: 772-777.
  26. Fueyo JM, Mendoza MC, Alvarez MA, Martin MC (2005) Relationships between toxin gene content and genetic background in nasal carried isolates of Staphylococcus aureus from Asturias, Spain. FEMS Microbiol Lett 243: 447-454.
  27. Holtfreter S, Grumann D, Schmudde M, Nguyen HT, Eichler P, et al. (2007) Clonal distribution of superantigen genes in clinical Staphylococcus aureus isolates. J Clin Microbiol 45: 2669-2680.
  28. Becker K, Friedrich AW, Peters G, Von Eiff C (2004) Systematic survey on the prevalence of genes coding for staphylococcal enterotoxins SElM, SElO, and SElN. Mol Nutr Food Res 48: 488-495.
  29. Thomas D, Dauwalder O, Brun V, Badiou C, Ferry T, et al. (2009) Staphylococcus aureus superantigens elicit redundant and extensive human Vbeta patterns. Infect Immun 77: 2043-2050.
Citation: Gomes PLR, Malavige GN, Fernando N, Mahendra MHR, Seneviratne JKK, et al. (2011) Superantigen Profile of Staphylococcus Aureus Isolates from Patients with Atopic Dermatitis in Sri Lanka. J Clin Exp Dermatol Res 2:136.

Copyright: © 2011 Gomes PLR, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Top