Journal of Clinical & Experimental Dermatology Research

Journal of Clinical & Experimental Dermatology Research
Open Access

ISSN: 2155-9554

Research Article - (2013) Volume 4, Issue 5

Relationships among the Genotypes of Malassezia Globosa Colonizing Patients with Atopic Dermatitis, the Clinical Severity of the Disease, and the Level of Specific IgE Antibodies

Otomi Cho1, Mami Saito3, Ryoji Tsuboi3, Hiroshi Kato2, Akemi Nishikawa2, Sanae Nakajima1 and Takashi Sugita1*
1Department of Microbiology, Meiji Pharmaceutical University, Japan
2Department of Immunobiology, Meiji Pharmaceutical University, Japan
3Department of Dermatology, Tokyo Medical University, Japan
*Corresponding Author: Dr. Takashi Sugita, Department of Microbiology, Meiji Pharmaceutical University, 2-522-1 Noshio, Kiyose, Tokyo 204-8588, Japan, Tel: +81-424-95-8762 Email:

Abstract

Background: Various types of microorganisms colonize the skin surface, and some such as the bacterium Staphylococcus aureus and fungus Malassezia, exacerbate the symptoms of atopic dermatitis. Malassezia-specific IgE antibodies are present in the sera of patients with atopic dermatitis and the level thereof correlates with the severity of the condition. Malassezia has many genotypes. In the present study, we explored the relationships among the genotypes of Malassezia species colonizing patients with atopic dermatitis, the clinical severity of the disease, and the level of specific IgE antibody.

Methods: Scale samples were obtained from head or neck lesions of 74 patients with atopic dermatitis and 40 healthy subjects. The intergenic spacer (IGS) 1 region of the rRNA genes of M. globosa (the major flora of patients with atopic dermatitis) were amplified by PCR and directly sequenced. M. globosa-specific IgE antibody levels were determined using the AlaSTAT™ microplate system.

Results: Eighteen M. globosa IGS1 genotypes were detected in scale samples from patients with atopic dermatitis and healthy individuals. Of these, the proportion of the (GT)10:(CT)8 genotype increased with the clinical severity of disease and increasing levels of M. globosa-specific IgE antibodies, whereas this genotype was not found on the skin of healthy subjects.

Conclusion: A specific genotype of Malassezia selectively colonized the skin of patients with atopic dermatitis, contributing to the clinical severity of disease. Thus, a “bad Malassezia” may be present on the skin of patients with atopic dermatitis.

<

Keywords: Atopic dermatitis; Malassezia globosa; Genotype; IgE

Abbreviations

AD: Atopic Dermatitis; IGS: Intergenic Spacer

Introduction

Atopic dermatitis (AD) is a chronic disease exhibiting alternating periods of remission and deterioration. Environmental and genetic factors are involved in AD pathogenesis. AD patients generally exhibit dysfunctions of the skin barrier, allowing environmental substances to penetrate the body. Indeed, environmental allergen specific-IgE antibodies are readily detectable in patient sera [1-4].

The body is covered with various skin microorganisms including viruses, bacteria, and fungi, some of which exacerbate AD symptoms. Specific IgE antibodies against superantigens (enterotoxins) produced by Staphylococcus aureus are found in the sera of AD patients [5]. Of the cutaneous fungal microbiome, Malassezia species predominate at all sites on the body and comprise approximately 40-90% of all fungi [6,7]. Malassezia requires lipids for growth, and thus preferentially colonizes sebum-rich areas such as the head, face, and neck. Many studies have found that Malassezia exacerbates AD. Thus, AD symptoms improve after the administration of antifungal agents such as itraconazole and ketoconazole Malassezia-specific IgE antibodies are evident in the sera of AD patients but not healthy individuals, and the antibody level is correlated with symptom severity of the 14 Malassezia species, both M. globosa and M. restricta colonize the skin of all AD patients but the remaining species are detected in less than 40% of cases and the extent of Malassezia colonization is also correlated with symptom severity [8-11]. Together, these evidences suggest that cutaneous Malassezia species exacerbate AD. In our previous analysis of the skin microbiome of AD patients, we found that M. globosa (the major cutaneous fungus in AD patients) had many rRNA genotypes, and that the genotypes of species obtained from AD patients and healthy subjects differed [12]. The fungal rRNA gene encodes four rRNA subunits (5S, 5.8S, 18S, and 26S), and there are spacer regions between each one (Figure 1). The intergenic spacer (IGS) 1 region located between the 26S and 5S rRNAs has the short sequence repeats (CT)n and (GT)n. The number of (CT) n and (GT)n repeats in the M. globosa rRNA gene seems to be strainspecific.

clinical-experimental-dermatology-research-Primary-structure

Figure 1: Primary structure of the fungal rRNA gene. The fungal rRNA gene consists of four subunits (18S, 5.8S, 26S, and 5S) and two spacer regions (ITS and IGS), and approximately 100 copies are present in the genome (ITS: Internal Transcribed Spacer; IGS: Intergenic Spacer).

In the present study, we analyzed relationship among the number of (CT)n and (GT)n repeats in the M. globosa rRNA gene, the clinical severity of AD, and the level of M. globosa-specific IgE antibodies.

Materials and Methods

Patients

Our sample included 74 Japanese AD patients and 40 healthy subjects as controls. Our study protocol was approved by the Institutional Review Board of our institution and informed consent was obtained from each individual (Table 1). The clinical severity of AD was graded using the criteria of Hanifin and Rajka [13].

Subject Clinical sevirity Gender Number of subject Age (year) M. globosa specific IgE antibody value (IU/mL)
Mean ± SD Range Mean ± SD Range
AD pateints Mild Male 24 31.8 ± 9.7 17-49 10.6 ± 10.5 0-33
Female 13 27.0 ± 5.4 18-34
Moderate Male 14 28.4 ± 5.2 19-34 27.7 ± 35.4 0-152
Female 15 25.7 ± 6.9 18-45
Severe Male 5 30.6 ± 7.0 24-40 120.5 ± 69.9 40-204
Female 3 26.7 ± 8.9 21-37
Healthy subjects   Male 21 23.4 ± 3.3 19-32    
  Female 19 23.1 ± 2.9 19-28    
SD: standard deviation

Table 1: Subjects.

Determination of M. globosa genotypes

Scale samples were obtained from head or neck lesions by stripping using OpSite transparent dressings (Smith & Nephew, Hull, UK) [14]. M. globosa genotypes were determined by DNA sequencing of the IGS 1 regions of rRNA genes [12]. Malassezia DNA was extracted directly from dressings and the IGS 1 regions were amplified by nested PCR using species-specific primers. PCR consisted of initial denaturation at 94°C for 1 min; 30 cycles of 30 s at 94°C, 30 s at 54°C, and 30 s at 72°C; then a final extension at 72°C for 10 min. The primers used were gb-F1 (GCTTTCGAGTGGATACCACACT) and gb-R1 (GGAAATAGGATGAGAGAAACA). For nested PCR, 1 μL of the first amplification product was added to a new reaction tube and PCR was performed with an initial denaturation at 94°C for 1 min; 30 cycles of 30 s at 94°C, 30 s at 54°C, and 30 s at 72°C; then a final extension at 72°C for 10 min. The primers used were gb-F2 (TGCATACCACACTCGAGCGCTT) and gb-R2 (ATGTGGTAGTACGACATAGAGA). PCR products were directly sequenced.

Determination of M. globosa-specific IgE antibody levels

M. globosa-specific IgE levels were determined using the AlaSTATTM microplate system (Diagnostic Products Corporation, Los Angeles, CA) according to the method of Kato et al. [15]. Briefly, the wells of a microtiter plate were coated with 100 μL amounts of Malassezia antigen in phosphate-buffered saline (PBS). Then serum (50 μL) was added, followed by peroxidase-labeled anti-IgE antibodies. After addition of a TMB (3,3′,5,5′-tetramethylbenzidine dissolved in hydrogen peroxide) substrate solution, the absorbance at 650 nM was measured at 1 s intervals for 5 min. IgE levels (U/mL) were calculated with the aid of a standard curve, and an IgE level greater than 0.35 U/ mL was defined as a positive result.

Results and Discussion

The PCR products amplified were about 300 bp in length and included the GT and CT repeats (Figure 2). A total of 9-19 GT repeats and 3-9 CT repeats detected in DNAs of the patients and healthy individuals. A total of 18 combinations were noted. Of these, 16 were found in samples from patients with mild disease and the genotype (GT)10:(CT)8 was present in 24.3% (9/37) of cases. In patients with moderate disease, (GT)10:(CT)8 was present in 41.3% (12/29). In patients with severe disease, 87.5% (7/8) of the patients had the (GT)10:(CT)8 genotype although a limited number of patients were examined. The genotypes (GT)19:(CT)5 and (GT)19:(CT)7 predominated in healthy subjects, and (GT)10:(CT)8 was not found (Figure 3). These findings suggest that M. globosa of a specific genotype becomes more predominant as disease severity increases. The levels of M. globosaspecific IgE antibodies in the sera of AD patients also increased as disease severity increased (Figure 4). Of the 9 and 12 patients with mild and moderate disease, respectively, who were colonized with the genotype (GT)10:(CT)8 strain, 5 (56%) and 11 (92%) had IgE-specific antibody levels over 30 IU/mL. When these patients were compared to those with less than 30 IU/mL, 92.3% (24/26) of the former patients had the genotype (GT)10:(CT)8 compared to only 10.4% (5/48) of the latter. Generally, both total IgE and Malassezia-specific IgE antibody levels are correlated with the clinical severity of AD [9]. Even in patients with mild or moderate disease, the specific genotype predominated in patients with high M. globosa-specific IgE antibody levels.

clinical-experimental-dermatology-research-detected-scales

Figure 2: (GT)n and (CT)n repeats in the IGS region of M. globosa. Two representative examples are shown. Genotype (GT)10:(CT)8 was detected from scales of Patient A whereas genotype (GT)15:(CT)9 was detected from scales of Patient B.

clinical-experimental-dermatology-research-moderate-disease

Figure 3: Distribution of each genotype in scale samples of patients with atopic dermatitis, and healthy subjects. Genotype (GT)10:(CT)8 was not detected in healthy subjects, however, the proportion of this genotype in patient scales increased with the clinical severity of AD.
n:n, (GT)n:(CT)n
Red, patients with severe disease; green, patients with moderate disease; light blue, patients with mild disease; dark blue, healthy individuals.

Why does a specific genotypic strain of M. globosa seem to affect (or at least appear to be associated with) the clinical severity of AD? We have no clear explanation as yet. However, physiological conditions including the lipid composition, water content, and/or pH of the skin surface may influence Malassezia colonization. Therapeutic agents given to AD patients may also affect selective skin microbial colonization. However, no patients in the present study received any antibacterial agent.

In conclusion, we found that M. globosa of a specific genotype was closely associated with the clinical severity of AD and increasing levels of specific IgE antibodies in sera. Further genotypic work is required.

References

  1. O'Regan GM, Irvine AD (2010) The role of filaggrin in the atopic diathesis. Clin Exp Allergy 40: 965-972.
  2. Sugita T, Zhang E, Tanaka T, Tajima M, Tsuboi R, et al. (2012) Atopic dermatitis and skin fungal microorganisms. In: Esparza-Gordillo J, Dkio I, Rijeka, (eds.), Atopic dermatitis–disease etiology and clinical management. InTech Open Access Company, Croatia.
  3. Hanifin JM, Rajka G (1980) Diagnostic features of atopic dermatitis. Acta Dermato-Venereol 92: 4-47.
  4. Sugita T, Suto H, Unno T, Tsuboi R, Ogawa H, et al. (2001) Molecular analysis of Malassezia microflora on the skin of atopic dermatitis patients and healthy subjects. J Clin Microbiol 39: 3486-3490.
Citation: Cho O, Saito M, Tsuboi R, Kato H, Nishikawa A, et al. (2013) Relationships among the Genotypes of Malassezia Globosa Colonizing Patients with Atopic Dermatitis, the Clinical Severity of the Disease, and the Level of Specific IgE Antibodies. J Clin Exp Dermatol Res 4:197.

Copyright: © 2013 Cho O, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Top
https://www.olimpbase.org/1937/