Journal of Clinical Microbiology and Antimicrobials

Journal of Clinical Microbiology and Antimicrobials
Open Access

Research Article - (2025)Volume 9, Issue 4

Shiga Toxigenic Escherichia coli Isolated from Hospitalized Patients: Prevalence and Susceptibility Pattern Evaluation

Fahima Aktera1 and Md Shamimuzzaman2*
 
*Correspondence: Md Shamimuzzaman, Department of Microbiology, Jashore University of Science and Technology, Jashore, Bangladesh, Email:

Author info »

Abstract

Escherichia coli is a common enteric pathogen responsible for dirrhoea and have a high predominance rate in tropical area. This study aims to identify and antimicrobial susceptibility testing of diarrheagenic E. coli in Dhaka city. Two hundred and eighteen Escherichia coli isolates were identified using cultural characteristics, automated biochemical test and Polymerase Chain Reaction (PCR). E. coli species were identified through VITEK 2 ID-GN card and 16S rRNA, stx1 and stx2 gene were detected by means of PCR. Among 223 isolates, 218 (97.75%) were correctly identified to the species level with the VITEK 2 system. In our study 45.7% (102 out of 218) isolates were identified within the excellent level and 32.7% (73 out of 218) isolates were in the very good level. Good and acceptable level identification was respectively 10.8% (24 out of 218) and 8.5% (19 out of 218). More importantly, 2.2% (5 out of 218) isolates were not able to identify. In this experiment, from 218 isolates of E. coli, stx1 and stx2 were detected in 86 (39.4%) and 122 (56.0%) respectively. In total 218 organisms were tested for antibiogram with AST-GN72 card after identification. We found that 81.6% of isolated strains (178 out of 218) exerted at least resistance to one antibiotic. Meanwhile, of 218 tested organisms, there were 15 species that showed VMEs. The final ME and mE shown organisms were 26 and 72. Overall 98.87% EA and 96.0% CA was calculated for microbes versus antimicrobial agent. The most common resistance pattern of multi-resistant serovars was to ampicillin, chloramphenicol, sulphonamide and trimethoprim. Ongoing research is an evidence for researcher to evaluate the etiology of emerging multi-drug resistance shiga-toxin producing E. coli.

Keywords

VITEK 2; ID-GN card; AST GN-72 card; stx1 gene; stx2 gene; 16S rRNA; Multi-drug resistant

Introduction

Diarrhea is the second most prevalent cause of death in children under the age of five. There are options for both prevention and treatment. Each year, diarrhea kills over 525000 children under the age of five. Around 1.7 billion children worldwide have diarrheal sickness each year and one of the primary causes of malnutrition in children under the age of five. It frequently lasts for a few days and might cause dehydration because of fluid loss. The first signs of dehydration are irritation and a lack of the customary stretchiness of the skin.

Infectious diarrhea can be brought on by bacterial, viral or parasite illnesses. In the United States, Shiga-toxin-producing Escherichia coli, such as E. coli O157:H7, are the most common cause of infectious bloody diarrhea. Infections with Campylobacter spp., Salmonella spp., Shigella spp. and some types of Escherichia coli usually result in bacterial diarrhea [1].

Depending on the virulence factors they possess, virulent Escherichia coli strains can either cause non-inflammatory diarrhea (watery diarrhea) or inflammatory diarrhea (dysentery with stools typically including blood, mucus and leukocytes). Virulence factor genes of enteric E. coli pathotypes: Colonization (bfp, eae, tir), fitness (sdiA, iutA, iucB, yjaA), toxins (stx1, stx2, estA, estB, LT I, LT II, eatA, astA) and effectors (espA, espB, espC, espD, espF) more than 90 [2]. There are nine main pathotypes of intestinal E. coli that have been extensively researched.

A unique collection of features that have successfully persisted in the host through horizontal gene transfer have been acquired by different E. coli strains as they have evolved [3,4]. Based on the collection of virulence determinants obtained, the five major DEC pathotypes are Enteropathogenic E. coli (EPEC), enterohemorrhagic (Shiga toxin-producing) E. coli (EHEC/ STEC), enteroaggregative (EAEC), enterotoxigenic (ETEC) and enteroinvasive (EIEC) [5].

American clinical laboratories frequently employ automated AST systems. However, several problems with failure, such as β-lactam resistance, have been documented [6]. For identifying meropenem, cefepime and imipenem resistance, individually, bioMérieux's Vitek 2 outperformed Kirby-Bauer's disk diffusion and broth micro-dilution at a lower cost [7]. As a result, CLSI and FDA advise changing the breakpoints for Escherichia coli spp. as well as for Enterobacteriaceae. Currently, the MICs obtained with the system are subjected to 2017 FDA breakpoints, which are equivalent to 2014 CLSI M100 S-24 breakpoints.

Most familiar characteristic genes of E. coli O157:H7 which are commonly used as specific targets for PCR amplification are rfb (cell surface O-antigen), hlyA that produces enterohemolysis [8], eaeA (intimin, adhesive factor), stx1 (Shiga-like toxin 1), stx2 and fliC (Flagella H-antigen) [9]. Today, PCR offers a quick, practical and trustworthy method for determining the serotype of E. coli O157:H7. Paton and James [10,11], demonstrated the detection and characterisation of Shiga toxigenic E. coli using multiplex PCR assays for stx1, stx2, rfb, O157:H7, rfbO11, eaeA and enterohemorrhagic E. coli hlyA. An improved approach for quantifying and detecting bacteria in environmental samples is Direct PCR (DPCR) [12].

Shiga toxin-producing E. coli are identified by the production of one or more Shiga toxin types (stx1 or stx2 or their variations), which prevent host cells from making proteins, resulting in cell death. Since they affect Vero cells, these toxins are also known as verocytotoxins or Shiga toxins due to their resemblance to the toxin made by Shigella dysenteriae. E. coli isolates that are particularly virulent may express only stx1, only stx2 or both toxins. In comparison to Stx1 strains, Stx2 is known to be more toxic and is frequently linked to Hemorrhagic Colitis (HC) or Hemolytic Uremic Syndrome (HUS) in human infections [13].

Post-transcriptional modifications, methylation and pseudouridylation are all carried out on 16S rRNA. This type of genotypic approach involves the amplification of any phylogenetically informative targets, such as the 16S rRNA gene for identifying genera [14] and the 16S-23S rRNA for identifying species [15]. Possible roles for the changed nucleotides have been hypothesized [16]. All cells depend on their rRNA sequences to survive, because they are necessary for the machinery that produces proteins through complicated intra and intermolecular interactions [17].

Rapid antibiogram is now time-critical due to the massive sample load. We can solve this issue with the aid of VITEK 2 [18], with outstanding accuracy and precision, which considerably cuts down on handling time [19,20]. Our research aimed to determine the prevalence of EHEC/STEC and evaluate the severity of multi-drug resistant Escherichia coli isolated from dirrhoea infected patients around Dhaka city. Implicitly, we have shown how Escherichia coli become impregnable while treating with antibiotics. This study will assist national and international public health organizations in preventing the hazards posed by superbugs and informing global antibiotic resistance prevention measures. Moreover, this work and CLSI will give us a glimpse of the emerging mechanism of resistance and our vigilance activity.

Materials and Methods

Sample collection

Two hundred and twenty-six stool samples of diarrhea infected patient were collected from several hospitals in and around Dhaka, Bangladesh. We collected these samples in a stool sample container from pathology laboratory with patients’ information from eight different government hospitals. Samples were kept in an ice box and transported in National Control Laboratory, microbiology wing under Ministry of Health and Family Welfare, Bangladesh from March, 2022-April, 2023. Samples were pre-enriched aerobically for 24 hours in Buffered Sodium Chloride Peptone Broth (BSCPB) at 37°C. Following that, 1 ml of the pre-enriched culture was added to the MacConkey Broth (MCB). After being streaked on MacConkey Agar (MCA), the enriched culture was incubated for 24 hours in an aerobic environment at 37°C. Red and pink colonies on MCA have streaked onto Eosin Methylene Blue (EMB) agar media. Colonies on EMB medium that were purple with a metallic green sheen were later streaked on Trypticase Soy Agar (TSA) and cultured for 18 to 24 hours at 37°C. Gram's staining, cultural features, biochemical test identification using VITEK 2 ID-GN CARD and Polymerase Chain Reaction (PCR) were applied to identify bacteria cultivated in MCA, EMB and finally TSA agar. The AST-GN72 was used to test the microorganisms for antibiotic susceptibility. There are 18 antibiotics on the ASTGN72 card, representing various classes and generations [21].

Identification of bacteria

Gram’s staining method: Red and pink colonies on MCA and metallic green sheen colonies on EMB which were sub-cultured on TSA characterized morphologically using Gram’s staining technique according to the described method.

Colony morphology: Following a 24-hour incubation period at 37°C, colonies form MCA agar and EMB agar were examined for size, shape. Surface texture, edge, elevation, color and opacity.

Identification with VITEK 2 system: BioMérieux's VITEK 2 is a completely automated identification system. A readerincubator, filling-sealing unit, Windows®-based computercontrolled Advanced Expert System (AES) software, test cards and a database comprise this integrated modular system. For fermenting and non-fermenting gram-negative bacilli, the VITEK 2 Gram-Negative identification card (GN) is designed.

Because of biological processes and metabolic changes takes place inside the micro-wells of ID plastic cards, the system is able to sense color. With the use of fluorescence-based technology, it is a colorimetric identification. There are 64 microwells on each identity card. We tested the antibiotic susceptibility of Enterobacteriaceae gram negative bacilli using the AST-GN 72 card and the ID-GN card for identification. The ID-GN card has 64 wells; 16 of them are empty, 48 of them are filled with a substrate for a flurometric biochemical reaction and well no. 52 is a decarboxylase negative control well for a baseline comparison. These substrates are made to support a variety of biochemical and metabolic processes, including acidification, pH change alkalinization, the action of inhibitory compounds, enzymatic activity, hydrolysis, utilizing carbon sources and resistance. In little less than 10 hours final results are obtainable.

For suspension preparation, a single colony from non-selective TSA media was taken. A 12 mm by 75 mm polystyrene test tube with 3 ml of half-strength saline water (aqueous 0.45% to 0.5% NaCl, pH 4.5 to 7.0) was used for suspension preparation. DensiCheck plus was used to modify the turbidity within the predetermined range of 0.5 to 0.63 McFarland. The prepared suspension was loaded onto the cassette and inserted into the filling section after the turbidity was adjusted.

Specimen number, date of operation, expected identification, lab ID and isolate number were entered into the software by logging into Vitek 2 Advanced Expert SystemTM (AES). Before being placed in the filling box, cassettes were scanned by a scanner. After filling was finished, the cassettes were moved into the loading door, where they were automatically scanned. Cards are then sealed, filled and the transfer tube is cut off before being placed in the carousel incubator to be incubated at 35.51.0°C. Every 15 minutes, the results of each test reaction are read in order to gauge the well's turbidity or color change. Reference ATCC culture, Escherichia coli, ATCC no. 25922 were used to check the analysis's quality.

Analysis of identification result: Four options are provided by VITEK 2 AES for the analysis of identification results: A) Correct identification, when organisms are correctly identified to the species level. B) Low discrimination: The system suggested two or more species, but one of them is similar to the reference when strains with low discrimination cannot be resolved by straightforward additional testing. C) Misidentification, in which one or more species were suggested by the algorithm but were all misidentified compared to the reference. D) No identification, which signifies that no species names are suggested by the system.

Molecular detection of pathogenic genes in E. coli isolates by PCR assays

Template DNA extraction: Genomic DNA of Escherichia coli was extracted employing heat lysis technique. Eppendorf tubes containing 200 μl of PBS and pure E. coli colonies were heated for 10 minutes. The tubes were afterwards immediately placed on ice for ten minutes to provide cold shock. The supernatant was then collected and centrifuged for 10 minutes at 10,000 rpm to create a DNA template for PCR. Following is a description of the components of the PCR master mixture (25 μl) and PCR thermal profile: 6.5 ml of nuclease-free water, 12.5 ml of 2X PCR Master Mix (ADD Bio, Daejon, South Korea), 1.0 ml of forward primers, 1.0 ml of reverse primers and 4.0 ml of template (extracted DNA) are required. To amplify 16S rRNA, Stx1 and Stx2 of E. coli specific primers were used respectively (Table 1).

Primer Sequence Size (bp)
E. coli 16S rRNA (Forward) 5ÃйGACCTCGGTTTAGTTCACAGA3Ãй 585
E. coli 16S rRNA (Reverse) 5ÃйCACACGCTGACGCTGACCA3Ãй
E. coli Stx1 (Forward) 5ÃйCACAATCAGGCGTCGCCAGCGCACTTGCT3Ãй 606
E. coli Stx1 (Reverse) 5ÃйTGTTGCAGGGATCAGTCGTACGGGGATGC3Ãй
E. coli Stx2 (Forward) 5ÃйCCACATCGGTGTCTGTTATTAACCACACC3Ãй 372
E. coli Stx2 (Reverse) 5ÃйGCAGAACTGCTCTGGATGCATCTCTGGTC3Ãй

Table 1: Primers used in PCR for 16S rRNA, stx1 gene and stx2 gene.

Thermal profile of gene amplification: Initial denaturation was carried out at 94°C for 5 minutes. Then, denaturation was carried out for 30 seconds at 94°C. For two minutes, the annealing temperature was maintained at 52°C. A 45-second extension at 72°C was conducted followed by a 5-minute final extension at that temperature. Millions of copies were produced over the course of 35 cycles. Until electrophoresis was carried out, the thermal cycler was maintained at 4°C.

Preparation of agarose gel: 1.5 g of agarose was added to 100 ml of 1X TAE buffer in a conical flask. After that, the mixture was heated in a microwave for two minutes to dissolve it. The gel was then gently poured into a gel casting tray with a set of combs and allowed to solidify for a while. The gel was immersed in 1X TAE buffer in the electrophoresis device after forming a clot. From the gel, the combs were taken out. The DNA samples could then be loaded onto the gel.

Procedure of electrophoresis: For each sample, a micropipette was used to deposit 1 μl of 6X loading dye on a sheet of parafilm paper. In well of agarose gel, 5 μl of the PCR product was put together with the loading dye and thoroughly mixed. The gel electrophoresis was run at 100V for 30 minutes with the marker (a 100 bp DNA ladder) put in the first lanes.

Documentation of the PCR products: The gel's bands of PCR undergo a 10-minute ethidium bromide staining procedure before a 10-minute deionized water wash. Gel that had been stained with the products was evaluated using a UV transilluminator and the results were noted. A USB flash drive was used to copy the picture of the PCR band.

Antibiotic susceptibility test

Preparation of culture dilution: Vitek 2 AST-GN72 card (bioMérieux, Inc.) was used to assess E. coli's antibiotic resistance against 18 different antibiotics (n=218). There are 18 antibiotics on this card, divided into 11 different classes. Antibiotic classes include aminoglycoside, fluroquinolone, tetracyclines, nitrofurantoin, trimethoprim/sulfamethoxazole, ureidopenicillin/ inhibitors combinations, cephalosporin I, cephalosporin II/ cephamycin, cephalosporin III/IV, carbapenem and aminoglycosides.

Amoxicillin, ampicillin, piperacillin, cefoxitin, cefuroxime, cefepime, cefpodoxime, ceftazidime, ceftriaxone, gentamicin, tobramycin, ciprofloxacin, levofloxacin, tetracycline, nitrofurantoin and trimethoprim are among the antibiotics included in AST-GN72.

Identification was done along with tests for antibiotic susceptibility. In addition, 145 μl of the prepared and turbidityadjusted suspension was transferred into 3 ml of half-strength saline water into another polystyrene tube. The preparation process for the inoculum suspension was similar to that for the ID-GN card. The AST-GN72 card was placed in the cassette immediately after the ID-GN card. Additionally done simultaneously were the AES data input and labeling. Entry of AES data and labeling both took place simultaneously.

Analysis of susceptibility testing: In general, Essential Agreement (EA) is the percentage of MICs that are within one doubling dilution of the relevant CLSI or other reference data. We need to take into account two scenarios when examining the ASTA. Category Agreement (CA) and B. Discrepancies. According to NCCLS, microbial susceptibility is divided into three categories: susceptible, moderate and resistant. Very Major Errors (VME), Major Errors (ME) and minor Errors (mE) are the three classifications for discrepancies. When VITEK 2 reports a susceptible result but the reference method reports a resistant result, this is referred to as a VME. On the other hand, MA is present when the VITEK 2 system detects resistance but the reference technique reveals that it is susceptible. Minor errors (mE) occur when the reference technique indicates intermediate susceptibility while the VITEK 2 system indicates susceptible or resistance.

Results

Identification of E. coli with cultural and morphological characteristics

Through the use of MCA and EMB agar media, a total of 223 E. coli isolates were obtained from 226 samples. E. coli isolates from infected patient samples had red and pink colonies with black centers on MCA and purple color with metallic green sheen on EMB agar.

Gram staining of E. coli showed gram-negative rods in pairs or singles that was observed under a light microscope.

Identification of E. coli with VITEK 2 system

223 isolates were examined using a VITEK 2 ID-GN card according to cultural and morphological traits. The VITEK 2 system's organisms are listed in Table 1. Out of 223 isolates, 102 were properly identified to the species level with excellent (96%-99% likelihood) confidence level. Thence, the VITEK 2 system was able to identify 73 strains up to the species level, the confidence level was quite high (93%-95% probability). Additionally, the algorithm classified 19 isolates as acceptable level (85%-88% likelihood) and 24 isolates as good level (89%-92% probability). Five isolates identified from cultural characteristics was unidentified by VITEK 2. For low discrimination level identification, additional tests were required. When two to three taxa showed the same bio-pattern, it was considered discrepant. The lab report recommended more testing. The final identification was made using the reference technique after this test was completed.

Molecular detection of 16S rRNA, stx1 and stx2 gene of E. coli.

Detection of 16S rRNA: PCR primers targeting 16S rRNA of E. coli amplified 585 bp fragments of DNA confirming the identity of E. coli (Figure 1).

jcma-pcr

Figure 1: PCR assay for amplification of 16S rRNA of E. coli. Lane M: 100 bp size DNA ladder (Add Bio, Daejon, South Korea), lane (1-7): DNA extracted from E. coli.

Detection of Shiga toxin producing stx1 genes of E. coli: Only 19 out of 218 E. coli isolates (8.71%) were found to be positive for stx1 gene in PCR assay (Figure 2).

jcma-pcr

Figure 2: Amplification of 676 bp fragment of stx1 gene of E. coli by PCR assay. Lane M:100 bp size DNA ladder (Add Bio, Daejon, South Korea); lanes 1-5: DNA extracted from E. coli; lane 6: positive control and lane 7: Negative control.

Detection of Shiga toxin producing stx2 genes of E. coli: A total of 24 E. coli isolates (11.00%) were found to be positive for stx2 gene in PCR assay. But after individual PCR and gel run for stx1 and stx2 gene, another 32 (14.68%) isolates showed positive for both stx1 and stx2 genes. The results of PCR assays for stx2 pathogenic genes of E. coli are presented in (Figure 3). Thus total of 75 (34.4%) STEC isolates carried single or multiple stx gene. Where all 75 isolates are different, there is no common ETEC/ STEC in any group.

jcma-pcr

Figure 3: Agarose gel electrophoresis showing PCR amplicons of stx2 genes of E. coli. Lanes M: 100 bp size DNA ladder; Lanes 1-5: DNA extracted from E. coli: Lanes 1, 2, 4 and 5: stx2 positive E. coli. Lane 3: Negative control.

Antibiotic susceptibility tests

Total 218 isolates in all were tested for antibiotic susceptibility. Table 3 displays the findings of the antibiotic susceptibility test. In accordance with CLSI (2020) Performance Standards for Antimicrobial Susceptibility Testing, M100, 30th edition, and M11-S19, MICs from each antibiotic produced by the VITEK 2 system were compared (Table 2). Based on the most recent CLSI breakpoint criteria, resistant, intermediate and susceptible groups were also taken into account for each MIC. Calling range and breakpoint were also used to determine Category Agreement (CA). Tables 3 and 4 offer specific antimicrobial data and Table 3 displays the MIC, VME, ME and mE values.

 

Level of identification

Excellenta

Very gooda

Gooda

Acceptablea (Low discrimination)

Unidentified

Total no. of strain tested

No. of strain

102

73

24

19

5

223

Percentage

45.70%

32.70%

10.80%

8.50%

2.20%

 

Which strains were identified as “low discrimination” resolved by one and/or two simple tests (motility and serological test)

 

a

Identification level: Excellent (96%-99% probability), very good (93%-95% probability), good level (89%-92% probability), acceptable level (85%-88% probability)

 

Table 2: Performance of the VITEK 2 system for identification of E. coli by ID-GN card.

Out of the 218 tested organisms, 7 species displayed VMEs; however, 11 organisms did not exhibit VMEs until the MIC values were interpreted using the VITEK 2 breakpoint. The final ME suggested organisms are 15, but prior to repeat testing, ME status had been determined for 19 samples. The breakpoint of VITEK 2 was accused of the first errors. Therefore, for VME and ME, the repeated correction rate was 64% and 79%, respectively. Even after repeated screening of the initial 82 isolates against all 18 antibiotics, 67 (82%) mE were found. As a result, a total of 218 microorganisms vs. antimicrobial findings were analyzed, yielding an overall 98.86% EA and 95.95% CA. Furthermore, according to CLSI M100 breakpoints, the VITEK 2 indicated 7 VMEs, 15 MEs and 67 mE.

The following percentages represent the critical levels of agreement for resistance and susceptibility to various antibiotics (Table 3). Amoxicillin 100%, Ampicillin 100%, Piperacillin 92%, Cephalothin 100%, Cefazolin 100%, Cefoxitin 100%, Cefuroxime 99%, Cefpodoxime 96%, Ceftazidime 98%, Ceftriaxone 100%, Aztreonam 96%, Gentamicin 100%, Tobramycin 100%, Ciprofloxacin 100%, Levofloxacin 100%and Tetracycline 100%. While susceptibility testing took 6-15 hours to complete, complete identification findings might be achieved in as little as 4 hours.

Data for specific species and antibiotics are displayed in Tables 3 and 4. Figures 4 and 5 glimpses the summary for the resistive summary.

Class Antibiotic MIC calling range Breakpoint (CLSI 2020)1,2 No. of isolates with susceptibility2 No. (%) of error3
S I R Total R I S EA CA VME ME mE
Aminopenicilli/Inhibitor combination Amoxicillin/Clavulanic acid 2/1-32/16 ≤ 8/4 16/8 ≥ 32/16 218 196 13 9 218 (100) 215 (98.6) 0 (0) 0 (0) 3 (1.4)
Ampicillin 2-32 ≤ 8 16 ≥ 32 218 191 11 16 218 (100) 218 (100) 0 (0) 0 (0) 0 (0)
Ureidopenicill/inhibitor combinations Piperacilllin/ Tazobactam 4/4 - 128/4 ≤ 16 32-64 ≥ 128 218 126 41 51 200 (91.7) 182 (83.5) 0 (0) 2 (0.09) 16 (7.4)
Cephalosporin I Cephalothin1 2-64 ≤ 8 16 ≥ 32 218 192 2 24 218 (100) 218 (100) 0 (0) 0 (0) 0 (0)
Cefazolin 4-64 ≤ 2 4 ≥ 8 218 191 1 26 218 (100) 218 (100) 0 (0) 0 (0) 0 (0)
Cephalosporin II/Cephamycin Cefoxitin 4-64 ≤ 8 16 ≥ 32 218 140 32 46 218 (100) 213 (97.7) 2 (0.09) 0 (0) 3 (1.4)
Cefuroxime 1-64 ≤ 8 16 ≥ 32 218 133 35 50 215 (98.6) 215 (98.6) 0 (0) 0 (0) 0 (0)
Cephalosporin III/IV Cefpodoxime 0.25-8 ≤ 2 4 ≥ 8 218 78 57 83 208 (95.4) 205 (94.0) 0 (0) 0 (0) 3 (1.4)
Ceftazidime 1-64 ≤ 4 8 ≥ 16 218 69 38 111 213 (97.7) 207 (95.0) 0 (0) 2 (0.09) 4 (1.8)
Ceftriaxone 1-64 ≤ 1 2 ≥ 4 218 60 61 97 218 (100) 207 (95.0) 3 (1.4) 2 (0.09) 6 (2.8)
Monobactam Aztreonam 1-64 ≤ 4 8 ≥ 16 218 52 37 129 210 (96.3) 204 (93.5) 0 (0) 3 (1.4) 3 (1.4)
Aminoglycoside Gentamicin 1-16 ≤ 4 8 ≥ 16 218 44 29 145 218 (100) 213 (97.7) 2 (0.09) 2 (0.09) 1 (0.04)
Tobramycin 1-16 ≤ 4 8 ≥ 16 218 50 11 157 218 (100) 215 (98.6) 1 (0.04) 1 (0.04) 1 (0.04)
Fluroquinolone Ciprofloxacin 0.25-4 ≤ 0.25 0.5 ≥ 1 218 31 17 170 218 (100) 209 (95.9) 0 (0) 5 (2.3) 4 (1.8)
Levofloxacin 0.12-8 ≤ 0.5 1 ≥ 2 218 48 24 146 218 (100) 213 (97.7) 1 (0.04) 1 (0.04) 3 (1.4)
Tetracyclines Tetracycline 1-16 ≤ 4 8 ≥ 16 218 159 44 15 218 (100) 215 (98.6) 0 (0) 0 (0) 3 (1.4)
Miscellaneous Nitrofurantoin 16-512 ≤ 32 64 ≥ 128 218 92 70 56 218 (100) 182 (83.5) 6 (2.8) 8 (3.7) 22 (10.0)
Trimethoprim/Sulfamethoxazole 20 (1/19)-320 (16/304) ≤ 2/38 NA ≥ 4/76 218 70 5 143 218 (100) 218 (100) 0 (0) 0 (0) 0 (0)
1 The breakpoint of cefalotin is according to CLSI 2009, the rest of them are in pursuance of CLSI (2020)-M100, 30th edition
2 R=Resistant; I=Intermediate; S=Susceptible
3 EA=Essential Agreement; CA=Categorical Agreement; VME=Very Major Error; ME=Major Error; mE=Minor Error

Table 3: Performances of AST-GN72 card considering CLSI reference method.

Antimicrobial agent CLSI susceptibility breakpoint for Escherichia colic Susceptibility information from VITEK 2
MIC range and category agreement of identified Escherichia coli strains
Susceptible Intermediate Resistant MIC (μg/ml) range determined by VITEK 2 Resistant (%) Intermediate (%) Susceptible (%)
Amoxicillin/ Clavulanica acid ≤ 8/4 16/8 ≥ 32/16 0.015-16 196 (89.9) 13 (6.0) 9 (4.1)
Ampicillina ≤ 8 16 ≥ 32 0.015-32 191 (87.6) 11 (5.0) 16 (7.3)
Piperacilllin/Tazobactama ≤ 16 32-64 ≥ 128 0.03-32 126 (57.8) 41 (18.8) 51 (23.3)
Cephalothinb ≤ 8 16 ≥ 32 0.03-32 192 (88.0) 2 (0.09) 24 (11.0)
Cefazolina (blood) ≤ 2 4 ≥ 8 0.015-16 191 (87.6) 1 (0.04) 26 (11.9)
Cefoxitina ≤ 8 16 ≥ 32 0.12-32 140 (64.2) 32 (14.7) 46 (21.1)
Cefuroximea (parental) ≤ 8 16 ≥ 32 0.015-16 133 (61.0) 35(16.0) 50 (22.9)
Cefpodoximea surr.cefazoln ≤ 16 - ≥ 32 0.015-32 78 (35.8) 57 (26.1) 83 (38.0)
Ceftazidime (avibactam)a ≤ 8/4 - ≥ 16/4 0.015-32 69 (31.7) 38 (17.4) 111 (50.9)
Ceftriaxone ≤ 1 2 ≥ 4 0.015-16 60 (27.5) 61 (28.0) 97 (44.4)
Aztreonama ≤ 4 8 ≥ 16 0.015-16 52 (23.9) 37 (17.0) 129 (59.1)
Gentamicina ≤ 4 8 ≥ 16 0.12-32 44 (20.2) 29(13.3) 145 (66.5)
Tobramycina ≤ 4 8 ≥ 16 0.015-32 50 (22.9) 11 (5.0) 157 (72.0)
Ciprofloxacina ≤ 0.25 0.5 ≥ 1 0.12-32 31 (14.2) 17 (0.77) 170 (78.0)
Levofloxacina ≤ 0.5 1 ≥ 2 0.015-16 48 (22.0) 24 (11.0) 146 (61.0)
Tetracyclinea ≤ 4 8 ≥ 16 0.015-32 159 (72.9) 44 (20.1) 15 (6.8)
Nitrofurantoina ≤ 32 64 ≥ 128 0.015-16 92 (42.2) 70 (32.1) 56 (25.6)
Trimethoprim/Sulfamethoxazolea ≤ 2/38 NA ≥ 4/76 0.03-32 70 (32.1) 5 (2.3) 143 (65.6)
a CLSI (2020) Performance Standards for Antimicrobial Susceptibility Testing; M100, 30th edition
b CLSI (2009) Performance Standards for Antimicrobial Susceptibility Testing; M100-S19
c Breakpoint of Escherichia coli is parallel to Enterobacterales
d Number of resistant as interpretation of VITEK 2 automated report

Table 4: MIC range determined by method breakpoint (μg/ml).

jcma-pcr

Figure 4: Category agreement of E. coli against each antibiotic used in susceptibility test.

jcma-pcr

Figure 5: Antibiotic susceptibility pattern is shown here with heat map. Column represent antibiotics in AST card and rows represent STEC isolates; here cyan blue blocks indicate resistance; pink blocks reveal the susceptibility and blue blocks indicate intermediate action according to obtained minimum inhibitor concentration.

Discussion

Identification

Bassel et al. were the first to evaluate the capabilities of the VITEK 2 system with an ID-GP identification card to allow quick detection of pathogenic gram-positive cocci. Bassel demonstrated a 98.0% overall agreement, with 11.2% of the species requiring additional testing while 86.8% of the species level agreement was established without any additional testing. Unfortunately, in Bassel's experiment, 1.7% of isolates were incorrectly diagnosed and 0.3% were left undetermined. Although ID-GN cards are used in our investigation, the quality of identification is comparable; in this instance, 45.7% of the 223 isolates were identified at an excellent level. 32.7% of levels were identified with very good. Identification at the good and acceptable levels was 10.8% (24 out of 223) and 8.5% (19 out of 223), respectively. What's more, 2.2% (5 out of 223) of the isolates could not be identified. Escherichia coli, ATCC no. 25922, our reference ATCC culture, demonstrated exceptional level, which equals 96% to 99% likelihood each time.

The VITEK 2 ID-GN card has a species-level identification accuracy of 97.8% (218 out of 223). After performing some preliminary cultural-based sorting, we used the VITEK 2 system and ID-GN card to demonstrate 218 Escherichia coli. 218 of 223 isolates were accurately identified with a respectable degree of accuracy. Only 8.5% of the isolates from VITEK 2's lowdiscrimination identification results for strains were shown for these taxa. Low discriminants are resolved by two more tests, which validated the acceptance as Escherichia coli species without any ambiguity. He evaluated gram-negative rods by VITEK 2, which demonstrated 100% accuracy for Escherichia coli identification.

Even though our recognition rate wasn't perfect, we didn't discover any intra-species misidentifications. Cells that displayed cultural conformance, however, went unrecognized using a VITEK 2 ID-GN card. For Enterobacteriaceae, Caroline analyzed the VITEK 2 and ID-GN cards, however their research revealed no low discrimination.

The Polymerase Chain Reaction (PCR) based approach has been successfully used by Pollard et al., 1990 for the detection of 16S rRNA, stx1 and stx2 genes in E. coli species isolation and identification.

The virulence of STEC is known to mediate through Stx and eae or intimin.

Tahamtan Y et al., found the presence of stx1 and stx2 gene (10.27%) and (53.42%) respectively in 146 E. coli isolated from cattle using multiplex PCR.

Shi, Xiaorong found total 192 STEC strains, 93 (48.4%) were positive for stx1 only, 43 (22.4%) for stx2 only, and 56 (29.2%) for both stx1 and stx2. We detect 16S rRNA gene sequence to characterize the strains as a member of Escherichia coli.

Antimicrobial susceptibility test

The FDA (Food and Drug Administration) has authorized the AST test evaluation criteria with the fewest performance characteristics. The recommended values are: CA ≥ 90%, ME ≤ 3%, VME ≤ 1.5% and acceptable mE rates ≤ 10% (AST).

With the VITEK 2 ID-GN card, E. coli was quite accurately detected. After identification, an AST-GN 72 card was used to perform our Antimicrobial Susceptibility Test (AST). Even though we discovered some mE, ME and VME, the majority of them complied with FDA regulations. With the exception of nitrofurantoin, VME ranged from 0 to 1.5. Every value was within the FDA threshold when Nitrofurantoin's ME and mE were taken into account. However, other 17 antibiotics decapitate within value and most critically, 13 antimicrobial drugs lacked any VME. Only nitrofurantoin had a trend of surpassing the upper limit. Our findings were consistent with the trend that not many researches had evaluated the functionality of the VITEK 2 AST card for E. coli. Their category agreement and essential agreement are in line with our conclusion.

The VITEK 2 system's performance for AST and identification of harmful microbes like Enterobacterales was evaluated. AST is typically carried out using the Kirby-Bauer disc diffusion assay. This approach has some drawbacks, including subjectivity, handling error, inconsistent results and human error. We are more at ease because to VITEK 2's automated fluorescence-based technology, which is error-free. Before it is found to be pertinent to Escherichia and Klebsiella species, bioMerieux did not claim the AST-GN 72 card, which contains piperacillin/tazobactam (extra spectrum β-lactamase). Because some E. coli are reported to be cephalosporin resistant in different parts of the world and are able to produce extended spectrum β-lactamase, so ESBL may not be able to completely exclude E. coli from AST.

With the exception of 5 isolates in our study, VITEK 2 was able to identify all isolates based on cultural features. This could be the result of improper MacFarland preparation or the usage of more than one colony in the loop. In comparison to Tae Sun Kim et al., essential agreement and categorical agreement were shown to be superior.

Results discovered for many Escherichia coli species using VITEK 2 matched those reported by others, including Ibrahim A Naqid et al., Hogan, C. A. Bobenchik et al., and Caroline M. O'Hara et al., as well as MIC calling reference and CLSI reference. For Amoxicillin, Ampicillin, Cephalothin, Cefazolin, Cefuroxime, Cefpodoxime, Ceftriaxone, Tetracycline and Trimethoprim, no VME or ME was discovered; however, the MIC for Escherichia coli is high in a number of cases.

The CLSI reference is followed by VITEK 2. Regarding Tables 3 and 4, the MIC values and classification of E. coli isolates as resistant because they only exhibit in vitro efficacy rather than in vivo effectiveness for the following antibiotics: Amoxicillin, ampicillin, piperacillin, cephalothin, cefazolin, cefoxitin, cefuroxime, levofloxacin, tetracycline, nitrofurantoin and trimethoprim. According to CLSI, this resistance result shouldn't be reported as susceptible.

Species that are ampicillin-resistant on AST GN-72, VITEK 2 reported the presence of Escherichia coli. The primary contributing factor may be patients with gastroenteritis who often use ampicillin. The VITEK 2 system, reported in Table 3, also found amoxicillin-resistant E. coli. Other antimicrobial drugs like piperacilllin, cephalothin, cefazolin, cefoxitin, cefuroxime, cefpodoxime, ceftazidime, ceftriaxone, aztreonam, gentamicin, tobramycin, ciprofloxacin, levofloxacin, tetracycline, nitrofurantoin and trimethoprim were shown resistant by VITEK 2 for different species and serotypes (Table 4). It is noteworthy that cephalosporins, including cephalothin, cefazolin, cefoxitin, cefuroxime, cefpodoxime, ceftazidime and ceftriaxone, are frequently used in humans as therapeutic agents. According to P. D. Fey, T. J. Safranek, M. E. Rupp, et al., plasmid-mediated resistance to AmpC (CMY-2) β-lactamase was the cause of the emergence of cephalosporin resistance. Even third and fourth generation cephalosporins, such as ciprofloxacin and cefpodoxime, ceftazidime and ceftriaxone, which are frequently used to treat invasive infections and diarrhea, have developed resistance (Table 4). E. coli's development of class A ESBLs and class C cephalosporinases is most likely the primary reason. It appears that the VITEK 2 AST GN-72 card ESBL test is generally resistant to largespectrum cephalosporins; other researchers have noted similar pattern. Due to the overuse of carbapenems, this issue has increased. There is a significant therapeutic impact on medicine and healthcare due to the global rise in E. coli resistance to conventional antibiotic medications.

Gentamicin is an aminoglycoside that inhibits protein synthesis by binding to the bacterial 30S ribosome. These aminoglycosides have a wide range of actions. In Great Britain, gentamicin-resistant E. coli isolates were successfully isolated in 1986 by Wray and Bradley and in 1994 by Johnson and Naidoop. These investigations demonstrate the evolution of the gentamicin-resistant E. coli strain.

E. coli with trimethoprim resistance was isolated by Brolund A, Sundqvist M, Kahlmeter G and Grape. In this investigation, E. coli that was resistant to trimethoprim-sulfamethoxazole was isolated using VITEK 2. Trimethoprim is no longer regarded as a safe weapon against invasive Diarrheagenic Escherichia coli due to the growing resistance of diarrhoeagenic E. coli to sulfamethoxazole-trimethoprim. Currently, ampicillin and sulfamethoxazole-trimethoprim resistant strains are treated with cephalosporins and fluoroquinolones on a prescription basis.

A medication is considered multi-drug resistant if it is resistant to three or more different classes of antibiotics. Since the 1960's, this occurrence has been documented. After analyzing every ME, VME and mE, we came to the conclusion that a laboratory should first confirm the VITEK 2 performance using a commercial test with updated breakpoints. We should compare MICs with the CLSI reference technique for disc diffusion or broth dilution to a particular antibiotic for ESBL positive cases as well as ME, VME and mE.

Conclusion

In conclusion, multiplex PCR and hybridization are the better choices for their accuracy in identification. We minimized our limitations by using an automated identification system. Identification and categorization through VITEK 2 automated system helped to provide more reliable antibiogram. The prevalence of ESBL-producing E. coli and STEC was relatively higher. The study's findings revealed multi-drug resistant E. coli in diarrhea-infected patients, which presents a significant therapeutic challenge to human medicine. Therefore, it is necessary to control the use of antibiotics and mandate AST monitoring in hospital patients.

Conflict of Interests

The authors declare that there is no conflict of interest regarding the publication of this paper.

Acknowledgments

The authors acknowledge the Ministry of Health and Family Welfare, Dhaka, Bangladesh for providing lab expenditure. We appreciate hospitals' being able to provide samples in a cold chain. Special thanks to bioMerieux regional application and support team for their assistance.

Funding

This research was partially funded by Strengthening of Drug Administration and Management project of fourth HPNSDP (Health, Population and Nutrition Sector Development Program) under Health Service Division, Ministry of Health and Family Welfare in Bangladesh (grant No. 127-12703-224021021).

Authors' Contributions

Fahima Akter contributed to data curation, formal analysis, visualization, original draft; Md. Shamimuzzaman involved in conceptualization, data curation, funding acquisition, investigation, methodology, project administration, resources, software, supervision, validation and writing-review and editing.

Institutional Review Board Statement

Not applicable.

References

Author Info

Fahima Aktera1 and Md Shamimuzzaman2*
 
1Department of Microbiology and Hygiene, Bangladesh Agricultural University, Mymensingh, Bangladesh
2Department of Microbiology, Jashore University of Science and Technology, Jashore, Bangladesh
 

Citation: Aktera F, Shamimuzzaman Md (2025) Shiga Toxigenic Escherichia coli Isolated from Hospitalized Patients: Prevalence and Susceptibility Pattern Evaluation. J Clin Microbiol Antimicrob. 9:216.

Received: 14-Jan-2024, Manuscript No. JCMA-24-29175; Editor assigned: 16-Jan-2024, Pre QC No. JCMA-24-29175 (PQ); Reviewed: 30-Jan-2024, QC No. JCMA-24-29175; Revised: 03-Jun-2025, Manuscript No. JCMA-24-29175 (R); Published: 10-Jun-2025 , DOI: 10.35248/ jcma.25.09.253

Copyright: © 2025 Aktera F, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Top