Fisheries and Aquaculture Journal

Fisheries and Aquaculture Journal
Open Access

ISSN: 2150-3508

Research Article - (2015) Volume 6, Issue 4

Morphological and Molecular Characterization of Diplozoon kashmirensis; D. aegyptensis and D. guptai Collected from Fishes of Kashmir Valley- India

Fayaz Ahmad1, Khalid M Fazili2, Tanveer A Sofi1*, Bashir A Sheikh1, Ajaz A Waza2, Rabiya Rashid2 and Tantry Tariq Gani3
1Department of Zoology, University of Kashmir, Srinagar, India, E-mail: rajafayazali@gmail.com
2Department of Biotechnology, University of Kashmir, Srinagar, India, E-mail: rajafayazali@gmail.com
3Sheri Kashmir Institute of Medical Science-Soura, Srinagar, India, E-mail: rajafayazali@gmail.com
*Corresponding Author: Tanveer A Sofi, Department of Zoology, University of Kashmir, Srinagar-190006, India, Tel: 09797127214 Email:

Published Date: Jan 01, 1970

Abstract

The study reports the results of molecular characterization of the Internal Transcribed Spacer (ITS) of ribosomal DNA of 3 Monogenean species using polymerase chain reaction (PCR), nucleotide sequencing and construction of phylogenetic trees from different fish hosts of Kashmir. The present study shows that the size of the amplified product is 873bp long for D. kashmirensis, 1120bp long in D. aegyptensis and 687bp long in D. guptai revealing that there are intraspecific differences in their base pair lengths. Guanine and Cytocine (G+C) content of three Diplozoon species was found nearly constant for three species i.e., 47% (D. kashmirensis); 47% (D. aegyptensis) and 48% (D. guptai), this GC richness contributes to physical attributes of RNA structures, as there is correlation between GC content and optimal growth temperature. An important observation during the present study has been noticed that Schizothorax niger is infected by all the three species of Diplozoidae; D. kashmirensis; D. aegyptensis and D. guptai, but when all six fishes were collected simultaneously, parasitism by all the parasite species was never observed. Phylogenetic trees Maximum Parsimony (MP), Maximum Likelihood (ML) and Neighbor Joining (NJ) showed that D. kashmirensis and D. aegyptensis share a common host Carassius carassius and S. niger.

Keywords: Diplozoon, Ribosomal DNA, Schizothorax, Kashmir,Phylogenetic trees.

Introduction

Monogeneans belonging to the Diplozoidae are common parasites on the gills of cyprinid fish. The life cycle is direct, including freeswimming oncomiracidia, larval stage (diporpa) and adult. Two larvae (diporpae) permanently fuse into a pair to form the sexually maturated adult. In the adult, the vitellaria and almost all the internal organs are situated in the anterior part of the body. The female and male reproductive organs and terminal part of the gut are situated in the posterior part. The attachment apparatus of adults consist of four pairs of clamps and a pair of small central hooks situated on the ventral side of the opisthaptor. Due to the complicated determination of several groups of monogenean parasites, molecular markers based on species-specific variability in the ribosomal DNA region (rDNA) their cytogenetics have been designed and shown to be useful for precise species identification [1-5]. The interspecific nucleic acid variability of Internal Transcribed Spacers of rDNA (ITS) has also been used to distinguish diplozoid parasites [6-11].

From the available data, it has been concluded that morphological and metrical differences in the clamp size, pharynx size, prohaptoral length, opisthohaptoral length, sucker distance, testis, ovary and egg size were the major criteria for species determination. Species deterimination of trematodes is difficult and demands great skill and experience. As the structures of taxonomic importance (central hooks, clamps etc.,) grow gradually and the measurements of sclerotized structures are variable, species determination of trematodes in different developmental stages is not always clear. There are still some unclear descriptions of trematode species that differ only by host species, and some studies that did not employ recommended criteria [12,13]. Molecular biology techniques have been used as objective methods to distinguish between parasite species. The rDNA genes, particularly the 28S gene, have been found generally useful in molecular taxonomy and phylogeny of parasites [14-16]. However, there are no published molecular studies of trematode genomes from the Kashmir valley. The present study reports the results of molecular analysis of the Internal Transcribed Spacer (ITS) of ribosomal DNA of 3 Monogenean species namely Diplozoon kashmirensis Kaw, Diplozoon aegyptensis Fischthal et Kuntz, Diplozoon guptai [17] using Polymerase Chain Reaction (PCR), nucleotide sequencing and construction of phylogenetic from different fish hosts of the Kashmir valley.

Materials and Methods

Parasite material

Parasite specimens of Diplozoon spp. were collected from the Carassius carassius; Cyprinus carpio communis; C. c. specularis; Schizothorax niger; S. esocinus; S. curvifrons and S. plagiostomus of Kashmir and were used for DNA extraction. Samples were immediately fixed in 70% alcohol after collecting from the gills, gill cover, mouth cavity, eyes & fins of host fish. These samples were remained in alcohol until the present study.

DNA isolation

Parasite specimens of three Diplozoon species were collected from fish hosts of Carassius carassius; Cyprinus carpio communis; Schizothorax curvifrons; Schizothorax esocinus; Schizothorax niger and Schizothorax plagiostomus from Wular lake, Anchar lake, Dal lake, Manasbal lake, River Jhelum and River Sindh of Kashmir valley preserved in 100% ethanol for genomic DNA extraction and stored at-200C for good quality of DNA. For DNA extraction ethanol was removed from parasites as per the protocol given by [18] and as such, these specimens were air dried to remove ethanol. The resultant DNA was examined on 1.5% agrose-TAE gels, stained with ethidium bromide (EtBr) and visualized under UV light.

Results

Morphological characterization

The present specimens having rectangular opisthaptor with four pairs of clamps and two individuals in form of a cross belongs to genus Diplozoon Nordmann, 1832. When compared D. kashmirensis with D. aegyptensis, they showed similarity in comparative size of clamps, size of eggs, form of oral suckers but differs in the proportion of body length to its breadth, shape of ovary, shape and position of testis. D. kashmirensis resembles D. guptai in egg size, absences of sticky glands in the anterior part, position of testis with respect to ovary, extent of vitellaria and in the arrangement of intestine in hind portion of the worm but shows strong variations as regards total body length, size ratios, clamp size, the shape & size of testis and also prepharynx size. The variations of the three species can be regarded as intraspecific variations due to geographical isolation and are not sufficient for the creation of new species and thus the present specimens are described as D. kashmirensis Kaw, 1950; D. aegyptensis Fischthal et Kuntz, 1963 and D. guptai [17-24] (Table 1).

Species Particulars
Particulars Total Body Length Forebody Hind body Length ratio between fore & hind body Clamp size Testis Egg size Anterior suckers Prepharynx Pharynx Host Site Locality
D. kashmirensis
Kaw, 1950
2.3-4.32 1.4-2.64 x
0.71-1.51
0.9 x 1.72 x
0.5-0.69
1:0.646 0.15 x 0.075
0.166 x 0.076
0.154 x 0.075
0.140 x 0.074
0.16 x 0.27-0.29 0.27 x 0.29 x
0.07-0.09
0.063-0.074 x
0.045-0.063
0.065 0.065-0.075 Schizothorax sp. Gills Dal Lake, Kashmir
D. aegyptensis
Fischthal et Kuntz, 1963
4.529 (3.62-5.77) 2.665 x 0.558 (1.879-3.452 x 0.299-0.836) 1.128 x 0.178 (0.867-1.871 x 0.130-0.245) ----- 0.070 x 0.097
0.065-0.079 x
0.092-0.102
0.136 x 0.08 (0.103-0.19 x 0.063-0.093) 0.292 x 0.107 (0.524-0.313 x 0.081-0.132) 0.038 x 0.07 (0.029-0.046 x 0.065-0.079) 0.027
(0.020-0.034)
0.062 x 0.044 (0.051-0.075 x 0.040-0.050) Labeo forskalii Gills Giza Fish Market,
Giza Fish Market, Egypt
D. aegyptensis Fayaz et Chishti 1993 4.2 (3.95-4.25) ----- ----- ----- 0.114 (0.10-0.124) x 0.045 (0.04-0.048) 0.155 (0.14-0.17) x 0.105 (0.10-0.11) 0.25 (0.22-0.28) x 0.082 (0.076-0.088) 0.048 (0.032-0.064) 0.054 (0.041-0.068) 0.064 (0.056-0.072) x 0.047 (0.044-0.05) Schizothorax niger Gills Dal lake, Kashmir
Diplozoon guptai Fayaz et Chishti 1999 1.873 (1.28-2.55) 1.66 x 0.604 (0.755-0.144 x 0.44-0.65) 0.603 x 0.395 (0.46-0.76 x 0.289-0.48) 1:0.523 (1:0.4-0.639) 0.102 x 0.045
0.106 x 0.032
0.093 x 0.038
0.081 x 0.035
0.813 x 0.0786 (0.076-0.12 x 0.052-0.128) 0.245-0.07 (0.228-0.268 x 0.06-0.08) 0.056 x 0.05 (0.04-0.08 x 0.032-0.072) 0.0356 (0.03-0.042) 0.057 x 0.025 (0.044-0.069 x 0.02-0.028) Schizothorax niger; S. esocinus; Labeo sp. and Carasius carassius Gills Dal and Anchar Lake, Kashmir

Table 1: Comparative Morphological characteristics of Diplozoon species (measurements in mm).

PCR amplification

The PCR amplified products of ITS regions of rDNA were successfully obtained using the primers (Table 2). PCR amplification was carried out to amplify ITS region of Diplozoon species (Table 3). The size of the amplified product was found to be 873bp long for D. kashmirensis; 1120bp long in D. aegyptensis and 687bp long in case of D. guptai (Figure 1). In BLAST search of these sequences, they showed similarity with other Diplozoon spp. (Table 3). In bioinformatics analysis, the results tallied with those of the earlier study; hence, the same are not repeated here in. Based on morphological studies, these species were identified as belonging to three Diplozoon species. The present results of the molecular analysis corroborate the species identification of these forms. Therefore, it can be assumed that the present species recovered from the different fish hosts of water bodies of Kashmir valley is D. kashmirensis Kaw, Diplozoon aegyptensis Fischthal et Kuntz, and Diplozoon guptai [24].

Species Primer Designed GenBank Accession Number Author and Year
Diplozoon kashmirensis Kaw, 1950 Forward AF 369758 to AF 369761 Sicard et al., 2001
Cer5.8S 2249:5/GCTCACGTGACGATGAAGAG3/
Diplozoon aegyptensis Fischthal et Kuntz, 1963 Reverse
Cer28S 3116 :5/TTCGCTATCGGACTCGTGCC3/
Diplozoon guptai Fayaz and Chishti, 1999

Table 2: Primers used for Trematodes.

Monogenea Initial Denaturation Denaturation for 30 cycles Annealing Extension Final extension
Diplozoon kashmirensis; D. aegyptensis and D. guptai 95°C for 10 minutes 30 cycles at 95°C for 30 seconds 55°C for 30 seconds 72°C for 75 seconds 72°C for 10 minutes

Table 3: PCR assay of Monogeneans which were carried out in a thermocycler (Eppendorf Mastercycler Personal) under different conditions.

fisheries-aquaculture-journal-Anteroir-showing-prohaptor

Figure 1: (A). Whole specimen of D. kashmirensis, (B). Anteroir end showing prohaptor of D. kashmirensis, (C). Posteror end showing posthaphtors of D. kashmirensis, (D). Whole specimen of D. aegyptensis, (E). Forebody showing suckers & pharynx of D. aegyptensis, (F). Hindbody showing clamps & eggs of D. aegyptensis, (G). Whole specimen of D. guptai, (H). Posterior body showing posthaphtors of D. guptai.

[Reagents for PCR: Taq DNA polymerase 3 U/μl, dNTP mixture 100 mM, primers 20 pmols, 10 × TaqDNA Polymerase buffer (Genei), PCR water (Sterile milli-Q)].

Sequences deposited in GenBank

GenBank: AF973616; Diplozoon kashmirensis, complete sequence.

GenBank: AF973617; Diplozoon aegyptensis, complete sequence.

GenBank: AF973618; Diplozoon guptai, complete sequence.

The three monogenean species of Trematodes viz., Diplozoon kashmirensis Kaw, 1950; Diplozoon aegyptensis Fischthal et Kuntz, 1963 and Diplozoon guptai [17] which were recovered during the present study are used for molecular study for the first time.

Nucleotide sequences

PCR products were visualized and documented, and the sizes of the sequences were estimated. The sequence obtained from three different Diplozoon species were submitted to GenBank and their accession number acquired were AF973616; AF973617 and AF973618 (Table 4). Sequences were compared with other sequences of monogenean species from GenBank. When the BLAST search was performed, the query sequence showed maximum similarity with 28S rDNA sequence of Diplozoon spp. The nucleotide sequences obtained and shown in (Figures 2-5) are as raw sequences (Table 5).

S no Monogenean Species
Host
GenBank Accession No. Family Base pair length Authors Country Year
1. D. kashmirensis Kaw, 1950* Carassius Carassius, Cyprinus carpio cummunis, Schizothorax niger, S. esocinus, S. curvifrons AF973616 Diplozoidea 873 bp Present study India 2015
2. D. aegyptensis Fischthal et Kuntz, 1963* Carassius Carassius, Schizothorax niger; AF973617 Diplozoidea 1120 bp Present study India 2015
3. D. guptai Fayaz and Chishti, 1999* Schizothorax niger AF973618 Diplozoidea 687 bp Present study India 2015
4. D. bliccae (Glaser, 1965) Blicca bjoerkna AF369761 Diplozoidea 988 bp Sicard et al. France 2001
5. D. paradoxum Nordmann, 1832 Abramis brama AF369759 and AJ563372 Diplozoidea 769 bp Matejusova Czech Republic 2004
6. D. homoion Bychowsky & Nagibina, 1959 Rutilus rutilus, Scardinius erythrophthalmus AF369760 Diplozoidea 996 bp Sicard et al. France 2001

Table 4: Monogenean trematode species used for molecular comparison of ITS rDNA sequences along with their hosts, country and GenBank accession numbers for corresponding sequences (*Query sequence).

  Diplozoon kashmirensis Diplozoon aegyptensis Diplozoon guptai
Length 873 bp 1120 bp 687 bp
A 177 237 123
C 191 224 148
G 226 312 188
T 279 345 228
G+C 47% 47% 48%
Total No. of Amino Acids 280 353 219
Molecular Weight 30827 Da 38825 Da 24323 Da

Table 5: Summary of base pairs and amino acids of Diplozoon kashmirensis Kaw, 1950, Diplozoon aegyptensis Kuntz, 1963 and Diplozoon guptai Fayaz et Chishti, 1999.

fisheries-aquaculture-journal-Polymerase-Chain-Reaction

Figure 2: Polymerase Chain Reaction (PCR) products of Trematodes (Monogenea) M=marker; bp=base pairs (100 bp ladder), 1=Diplozoon kashmirensis Kaw, 1950, 2=Diplozoon aegyptensis Fischthal et Kuntz, 1963 and 3=Diplozoon guptai [24].

fisheries-aquaculture-journal-Raw-nucleotide-sequences

Figure 3: Raw nucleotide sequences of Diplozoon kashmirensis Kaw, 1950.

fisheries-aquaculture-journal-Diplozoon-aegyptensis-Fischthal

Figure 4: Raw nucleotide sequences of Diplozoon aegyptensis Fischthal et Kuntz, 1963.

fisheries-aquaculture-journal-sequences-Diplozoon-guptai

Figure 5: Raw nucleotide sequences of Diplozoon guptai [24].

Pairwise alignment

Pairwise alignments of Diplozoon species were made by using different softwares such as Gene Runner, DNA Dynamo, Chromas Pro. D. kashmirensis showed maximum similarity with those of D. bliccae where as D. aegyptensis showed maximum similarity with D. paradoxum and in case of D. guptai that showed maximum similarity to D. homoin (Tables 6-8).

D. kashmirensis
D. bliccae
6 6 ACTGCCTTGAGCATCGACTTCTTGAACGTAAATTGCGGCATTAGGCTCTGCTGATGCCAC
||| ||||||||||| ||||||||||| ||||||||||||| |||| |||||||||
GCTGACTTGAGCATCGATTTCTTGAACGTGAATTGCGGCATTACCCTCTAATGATGCCAC
65 65
D. kashmirensis
D. bliccae
66

66
GCCTAGCCGAGTGTCGGCATTAAATCTATCACGACGCTTAATTGGTCGTGGCTTAGTTTG
|||||||||||| ||||||||||||||| ||||||||||| |||||||||||||| |
GCCTAGCCGAGTATCGGCATTAAATCTAGCACGACGCTTATTTGGTCCTGGCTTAGAAAG
125 125
D. kashmirensis
D. bliccae
126

126
TTGTCAGCCGTCGTGTTGTACT---CAACGTGTTGTTCAGTTGTCAAGTCGACGGTATTA |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
TTGTCAGCCGTCGTGTTGTACTTGGCAACGTGTTGTTCTTTTGTCAAGTCGGCGGTATTA
185 185
D. kashmirensis
D. bliccae
186

186
TTGACGCTTGCCAAATGTAATGGAGAGTTTGTATATGC--AATATCTGCCGGTAGCCTGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TTGACGCTTGCCAAATGTAATGGAGAGTTTGTATATGCGAAATATCTTCCGGTAGCCTGT
245 245
D. kashmirensis
D. bliccae
246

246
TGGTGTTGGCTACGCTGCCCCGTGTATGGTTTATTTGCATTTTTGTGCATACCGATGGGG ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
TGGTGTTGGCTACGCTGCCCCGTGTATTTTTTATTTGCATTTTTGTGCATACCGATGGGG
305 305
D. kashmirensis
D. bliccae
306

306
TGGTTAGCTTCTCGTCATCAGTGCGTGTTTGCCGGTGG-GTCGTGGCGTGGGAATTTCAA ||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||
TGGTTAGCTTCTCGTCAGCAGTGCGTCCTTGCCGGTGGTGTCGTGGAATGGGAATTTCAA
365 365
D. kashmirensis
D. bliccae
366

366
TAAGCATTTCTGAATGGTAATTGTGAAATTGTCAT---ATGTGCTGTTCTCTTGAGCCTT ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
TAAGCATTTCTGAATCCTAATTGTGAAATTGTCATTTTATGTGCTGTTCTCTTGAGCCGC
425 425
D. kashmirensis
D. bliccae
426

426
TTGGCCCACGGGTTGTGCGGTGACCAGTGTTGCTTTGAATGCGAGCGCATGCATGCCAGG |||||||| |||||||| ||||||||| |||||||||||||| ||||||||||||||
ACGGCCCACTTATTGTGCGATGACCAGTGACGCTTTGAATGCGAGTGCATGCATGCCAGG
485 485
D. kashmirensis
D. bliccae
486

486
TCGCAGCCTATTTGTGATCGCGAC-GTGCTTTGCTTGTGTTCTGCGTTTAATTTTTGTCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TCTCAGCCTATTTGTGATCGCGACAGTGCTTTGCTTGTGTTCTGCGTTTAATTTTTGTCA
545 545
D. kashmirensis
D. bliccae
546 546 CTGTTTCTTGCGAATGAGCGAGTCTGGCCCGAGACGAGATTATGTGCCCATGTCGTGCTG ||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||
CTGTTTCCCGCGAATGAGCGAGTCTGGCCCGAGACGAGAGCATGTGCCCATGTCGTGCTG
605 605
D. kashmirensis
D. bliccae
606

606
TGCAGACATTACTACTCCATTGGTCGCTAAGTGCATATCGGTGTC--CCGTATTCTACTG ||||||||||||||||||||| |||||||||| ||||||||||||||||||| |||||
TGCAGACATTACTACTCCATTCTTCGCTAAGTGTGTATCGGTGTCACCCGTATTTTACTG
665 665
D. kashmirensis
D. bliccae
666

666
TACTGCTGTGGTGTGTGCACCTGACCTCGGATTAGGCGTGATTACCCGCTGAACTTAAGC |||| ||||||||| ||||||||||| |||||||||||||| ||||||||| |||||||
TACTTCTGTGGTGTATGCACCTGACCAAGGATTAGGCGTGATCACCCGCTGAGCTTAAGC
725 725
D. kashmirensis
D. bliccae
726

726
ATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCTT-GTAACGGCGAGTGAACA |||||||| |||||||||||||||||||||| ||||||||||||||| ||||||||||
ATATCAATGGGCGGAGGAAAAGAAACTAACCACTATTCCCTTAGTAACGTCGAGTGAACA
785 785
D. kashmirensis
D. bliccae
786

786
GGGATTAGCCCAGCACCGAAGCTGCGGTC--TTGGCCGTTCGGCAATGTGGTGTTTAGGT ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||
CCGATTAGCAAAGCACCGAAGCTGCGGTCTTTTGGCCGTTCGGCAATCCGGTGTTTAGGT
845 845
D. kashmirensis
D. bliccae
846

846
TGGCATACTCAGGCGATGTACTGTGTAG
| ||||||||||||||||||||||
TATCATACTCAGGCGATGTACTGTGCCC
873 873

Table 6: Pairwise alignments of the 28S rDNA ITS consequences of Diplozzon kashmirensis and Diplozoon bliccae, numbering refers to ITS sequences.

D. aegyptensis
D. paradoxum
1 4 TGCAAACTGCCTTGAGCATCGACTTCTTGAACGTAAATTGCGGCATTAGGCTCTG-CTGA
||||||||||||||||| |||||||| ||||||||||| ||||||||||||||| ||||
TGCAAACTGCCTTGAGCCTCGACTTCCCGAACGTAAATTACGGCATTAGGCTCTGCCTGA
59 63
D. aegyptensis
D. paradoxum
60 64 TGCCACGCCTAGCCGAGTGTCGGCATTAAATCTATCACGACGCTTAATTGGTCGTGGCTT
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||
TGCCCGACCTAGCCGAGTGTCGGCATTAAATCTATCACGACATAATATTGGTCGTGGCTT
119 123
D. aegyptensis
D. paradoxum
120 124 AGTTTGTTGTCAGCCGTCGTGTTGTACTTGGCAACGTGTTGTTCAGTTGTCAAGTCGACG
|||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||
AGTTTGTTAAAAGCCGTCGTGTTGTACTTAACAACGTGTTGTTCAGTTGTCAAGTAGACG
179 183
D. aegyptensis
D. paradoxum
180 184 GTATTATTGACGCTTGCCAAATGTAATGGAGAGTTTGTATATGCGAAATATCTGCCGGTA
||||||||||||||||||||||||||||||||||| | |||||||||||| || ||||
GTATTATTGACGCTTGCCAAATGTAATGGAGAGTTAG-NDATGCGAAATATCCGCTGGTA
239 242
D. aegyptensis
D. paradoxum
240 243 GCCTGTTGGTGTTGGCTACGCTGCCCCGTGTATGGTTTATTTGCATTTTTGTGCATACCG
|||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||
GCCTGTTGGTGTTGGCAACGCTGTCCCGTGTATGGTTTACTTGCATTTTTGTGCATACCG
299 302
D. aegyptensis
D. paradoxum
300 303 AT-GGGGTGGTTAGCTTCTCGTCATCAGTGCGTGTTTGCCGGTGGTGT----C-GTGGCG
|| |||| |||||||||| ||||||||| ||||||||||||||||||| | ||||||
ATGGGGGCGGTTAGCTTCGCGTCATCAGAGCGTGTTTGCCGGTGGTGTATTGCAGTGGCG
353 362
D. aegyptensis
D. paradoxum
354 363 TGGGAATTTCAATAAGCATTTCTGAATGGTAATTGTGAAATTGTCATTTTATGTGCTGTT
||||||||||||| ||||||| |||||||||||||| |||||| ||||||||||||||||
TGGGAATTTCAATGAGCATTTGTGAATGGTAATTGTTAAATTGCCATTTTATGTGCTGTT
413 422
D. aegyptensis
D. paradoxum
414 423 CTCTTGAGCCTTTTGGCCCACGGGTTGTGCGGTGACCAGTGTTGCTTTGAATGCGAGCGC
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||
CTCTTGAGCCTTTTGGCTTTCGGGTTGTGCGGTGACCAGTGTTGCTTTGAATGCGTGCGC
473 482
D. aegyptensis
D. paradoxum
474 483 ATGCATGCCAGGTCGCAGCCTATTTGTGATCGCGACAGTGCTTTGCTTGTGTTCTGCGTT
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
ATGCATGCCAGGTCGCAGCCTA-TTGTGATCGCGACAGTGCTTTGCTTGTGTTCTGCGTT
533 541
D. aegyptensis
D. paradoxum
534 542 TAATTTTTGTCACTGTTTCTTGCGAATGAGCGAGTCTGGCCCGAGACGAGATTATGTGCC
||||||||||||||| |||||| ||| |||||| || ||||||| |||||| ||||||
TAATTTTTGTCACTGCCGCTTGCGTATGTGCGAGTGTGACCCGAGATGAGATTGTGTGCC
593 601
D. aegyptensis
D. paradoxum
594 602 CATGTCGTGCTGTGCAGACATTACTACTCCATTGGTCGCTAAGTGCATATCGGTGTCACC
|||||| |||||||| ||||||||||||||| |||||||||||||||| ||||||||| |
CATGTCATGCTGTGCTGACATTACTACTCCACTGGTCGCTAAGTGCATGTCGGTGTCATC
653 661
D. aegyptensis
D. paradoxum
654 662 CGTATTCTACTGTACTGCTGTG--GTGTGTGCACCTGACCTCGGATTAGGCGTGATTACC
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
AGTATTCTACTGTACTGCTGTGTTGTGTGTGCACCTGACCTCGGATTAGGCGTGATTACC
711 721
D. aegyptensis
D. paradoxum
712 722 CGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCTTAGTA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCTTAGTA
771 781
D. aegyptensis
D. paradoxum
772 782 ACGGCGAGTGAACAGGGATTAGCCCAGCACCGAAGCTGCGGTCTTTTGGCCGTTCGGCAA
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
ACGGCGAG----CAGGGATTAGCCCAGCACCGAAGCTGCGGTCTTTTGGCCGTTCGGCAA
831 841
D. aegyptensis
D. paradoxum
832 842 TGTGGTGTTTAGGTTGGCATACTCAGGCGATGTACTGTGCTAAGTCCATTCATGAATATG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TGTGGTGTTTAGGTTGGCATACTCAGGCGATGTACTGTGCTAAGTCCATTCATGAATATG
891 901
D. aegyptensis
D. paradoxum
892 902 GCTAGCTATCTGGCCCAGAGAGGGTGAAAGGCCCGTGAGCATAGTGCGTCGTTCTGTCTT
||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||
GCTAGCTATCTGGCCCAGAGAGGGTGAAAGGCCCGTGAGCATAGTACGTTGTTCTGTCTT
951 961
D. aegyptensis
D. paradoxum
952 962 AGTCAACCGTTGAGTCGGGTTGTTTAGGAATGCAGCC
|| |||||||||||||||||||||||| ||||||||
AGCCAACCGTTGAGTCGGGTTGTTTAGTAATGCAGCA
988 998

Table 7: Pairwise alignment of the 28S rDNA ITS consequences of Diplozoon aegyptensis and Diplozoon paradoxum, numbering refers to ITS sequences.

D. guptai
D. homoion
9 6 ACTGCCTTGAGCATCGACTTCT--AACGTAAATCGCGGTATTAGGCTCTGCCTGATGCCA |||| |||||||||||| ||||||||||| ||| |||| |||| |||| ||||||||
ACTGACTTGAGCATCGATTTCTTGAACGTGAATTGCGGCATTACCCTCT-AATGATGCCA
68 64
D. guptai
D. homoion
69

65
CGCCTAGCCGAGTGTTGGCATTATATCTATCACGACGCTTAATTGGTCGTGGCTTAGTTT ||||||||||||| | ||||||| ||||| ||||||||||| |||||| ||||||||
CGCCTAGCCGAGTATCGGCATTAAATCTAGCACGACGCTTATTTGGTCCTGGCTTAGAAA
128 124
D. guptai
D. homoion
129

125
GTTGTCAGCCGTCGTGTTTTACTTTGCAACGTGTTGCTCAGTTGTAAAGTCGACGGTATT |||||||||||||||||| ||||| ||||||||||| || ||||| |||||| |||||||
GTTGTCAGCCGTCGTGTTGTACTTGGCAACGTGTTGTTCTGTTGTCAAGTCGGCGGTATT
188 184
D. guptai
D. homoion
189

185
ATTGACGCTTGCCAAATGTAATGGAGAGTGTGTATATGCGAAATTTCTGCCGG-AGCCTG ||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||
ATTGACGCTTGCCAAATGTAATGGAGAGTTTGTATATGCGAAATATCTTCCGGTAGCCTG
248 244
D. guptai
D. homoion
249

245
TTGGCGTTGGCGACGCTGCCCCGTGTATGGTTTACTTGCATTTTTGTGCATACCGATTGG |||| |||||| |||||||||||||||| |||| ||||||||||||||||||||| |||
TTGGTGTTGGCTACGCTGCCCCGTGTATTTTTTATTTGCATTTTTGTGCATACCGA-TGG
308 303
D. guptai
D. homoion
309

304
GGCGGTTAGCTTGTCGTCATCAGTGCGTGTTTGCCGGTGGTGATTTGTGGTGGCGTGGGA
|| ||||||||| |||||| |||||||| |||||||||| ||| |||| |||||
GGTGGTTAGCTTCTCGTCAGCAGTGCGTCCTTGCCGGTGG-----TGTCGTGGAATGGGA
368 358
D. guptai
D. homoion
369

359
ATTTCAATAAGCATTACTGAATGGTAATTAATAAATTGCCATTATATATGCTGTTCTCTT ||||||||||||||| |||||| ||||| |||||| |||| ||| ||||||||||||
ATTTCAATAAGCATTTCTGAATCCTAATTGTGAAATTGTCATTTTATGTGCTGTTCTCTT
428 418
D. guptai
D. homoion
429

419
GAGCCTTTTGGCCCACGGGTTGTGCGGTGACCAGTGTTGCTTTGAATGCGTGCGCATGCA ||||| |||||||| |||||||| ||||||||| |||||||||||| | |||||||
GAGCCGCATGGCCCACTTGTTGTGCGATGACCAGTGACGCTTTGAATGCGAGTGCATGCA
488 478
D. guptai
D. homoion
489

479
TGCCAGGTCGCAGCCTA-TTGTGATCGCGACAGTGCTTTGCTTGTGTTCTGCGTTTATTT ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||
TGCCAGGTCTCAGCCTATTTGTGATCGCGACAGTGCTTTGCTTGTGTTCTGCGT--AATT
547 538
D. guptai
D. homoion
548

539
GTTGTCACTGCTACTTGCATATGTGCGAGTGTGTACCCGGAATGAGATTTTGTGCCCATG
||||||||| | | || ||| |||||| || |||| | |||| ||||||||||
TTTGTCACTGTTTCCCGCGAATGAGCGAGTCTGG-CCCGAGACGAGAGCATGTGCCCATG
607 597
D. guptai
D. homoion
608

598
TCATGCTGTGCTGACATTACTTCTCCACTGGTCGATAAGTGCATGTCGGTGTCACCAGTA
|| |||||||| ||||||||| ||||| | ||| |||||| | ||||||||||| |||
TCGTGCTGTGCAGACATTACTACTCCATTCTTCGCTAAGTGTGTATCGG-GTCACCCGTA
667 657
D. guptai
D. homoion
668 658 CTTTGCTGTA-TT--GTG-T
||| ||||| || ||| |
TTTTACTGTACTTCTGTGGT
687 677

Table 8: Pairwise alignments of the 28s rDNA ITS consequences of Diplozzon guptai and Diplozoon homoion, numbering refers to ITS sequences.

Construction of phylogenetic tree

Phylogenetic trees were obtained by comparing the 28S rDNA sequences of the query parasite and other available sequences for related monogenean parasites. The E value was found to be zero up to the 100th sequence of BLAST search and the query coverage 95% and above. The species of D. kashmirensis and D. aegyptensis appeared to be the most closely related species, with well-supported clade by Neighbour joining and MP trees (Figures 6-8).

fisheries-aquaculture-journal-Unrooted-bootstrap-consensus

Figure 6: Unrooted bootstrap consensus tree of MP/ML/NJ analysis based on ML tree topology.

fisheries-aquaculture-journal-Phylogenetic-tree-depicting

Figure 7: Phylogenetic tree depicting the genetic relationship among three of Diplozoid species by Neighbouring Joining (NJ).

fisheries-aquaculture-journal-host-parasite-relationship

Figure 8: Construction of phylogenetic tree of parasites and hosts showing host parasite relationship of three Diplozoon species in Kashmir.

Above Table shows that Diplozoon kashmirensis having GenBank accession number AF973616 mostly resembles with Diplozoon bliccae with an accession number AF369761.1. Out of 867 base pairs of Diplozoon kashmirensis, 807bp match with that of Diplozoon bliccae i.e., 93.08% similarity with 15 gaps (1.73%).

From the Table 6 it is clear that Diplozoon aegyptensis having GenBank accession number AF973617 shows 94.13% similarity with Diplozoon paradoxum with an accession number AF369759.1. Out of 988 base pairs of Diplozoon aegyptensis, 930 bp match with that of Diplozoon paradoxum with 11 gaps (1.11%).

The present observation shows that Diplozoon guptai having GenBank accession number AF973618 shows 86.16% similarity with that of Diplozoon homoion having GeneBank accession mnumber AF369760.1 (Table 7). 585 bp of Diplozoon guptai matches with Diplozoon homoion with 15 gaps, out of total 679 base pairs.

Discussion

The rDNA second Internal Transcribed Spacer (ITS2) was amplified using primers Cer5.8S2249 and Cer28S3116 [7] for 3 species of diplozoids. Analysis of the ITS2 region following sequencing clearly allowed us discrimination at the species level and produced the same results as species identification made by using morphological structures. During the present study it was observed that the alignment of nucleotide sequences with those of other Diplozoon species of D. bliccae; D. paradoxum and D. homoion [2,6,7], clearly revealed the boundaries of the 5.8S and 28S rDNA genes, as the sequences in these species closely resembles to those of D. kashmirensis, D. aegyptensis and D. guptai. As noted in comparison of ITS2 sequences of Monogenean species, the first part of the ITS2 is also highly conserved, with only 6 variable sites in the first 65 nucleotides of the diplozoid sequences.

Species discrimination of diplozoids based on the shape of clamp sclerites and the length of the central hook can be difficult because of similarities in the shape of certain sclerites and overlapping ranges of central hook measurements. The PCR product of 3 species of diplozoids: D. kashmirensis; D. aegyptensis and D. guptai were clearly discriminated on the basis of nucleotide sequences which were different in their length of base pairs. The length of the PCR product could be useful to distinguish diplozoids from the genus Eu Diplozoon and Para Diplozoon from other diplozoids [2,6]. Length differences in the ITS2 have also been recorded in the genus Gyrodactylus [2,6] but are not generally as large as those found in the ITS1 region of Lamellodiscus and Gyrodactylus [2,6,19,20]. During the present study there are length difference of PCR products of three Diplozoon species i.e., D. kashmirensis contains 873bp; D. aegyptensis contains 1120bp and D. guptai contains 687bp of 28S rDNA genes, so on the basis of length of base pairs the three diplozoid species can be discriminated. ITS region have been found to be useful species markers for monogenean parasites [1,2-6] so, this method was performed to distinguish the diplozoid species. During the present study, the intraspecific variations within diplozoid species were studied and differences were detected in the ITS regions, but [2,6] studied that ITS region lacks intraspecific variation in groups of Monogenea which is due to the same species recovered from different hosts.

diplozoids are generally considered parasites of Cyprinid species but the host specificity differs and relates to geographical origin. In Eurasia, diplozoid occurrence is restricted to host fishes from the Cyprinidae and Perciformes families [2,6,8,10,21,22]. However, in Africa they also parasitize members of the Characidae [20,22]. All diplozoid species described in the present study are also host specific. ML, MP and NJ trees showed that D. kashmirensis; D. aegyptensis and D. guptai are closely related species, and this mirrors the close relationship of their hosts, thus all of these species are found in cyprinids from the same genus Schizothorax. These species have been described morphologically based on clamp shape, total body length, sucker, and pharynx length [17,24]. The present observations on molecular characterization demonstrate sufficient genetic variations between parasites from different hosts to confirm the validity of these species and that they appear to be host specific, as are many monogenean parasites. It may be speculated that the similarity of these species is a result of a relatively recent divergence of one from the other following a host-switching event. An important observation during the present study has been noticed that Schizothorax niger is infected by all the three species of Diplozoidae: D. kashmirensis; D. aegyptensis and D. guptai, but on all six fishes collected, simultaneous parasitism by all the parasite species was never observed. Two types of factors can be involved in the constitution of such a host-parasite system.

(a) Competition hypothesis: the installation of a first Diplozoon species prevents any other species from settling on the same gill. (b) Since natural hybridization has been reported between the two fishes, the introgression of genes from Carassius carassius into the genome of S. niger allows a host capture of the latter by D. aegyptensis and D. guptai but excludes the infestation by its natural parasite D. kashmirensis.

Conclusion

The present study has confirmed the existence of 3 species of diplozoids from 6 species of cyprinid fishes from the water bodies of Kashmir valley. All the species were clearly distinguished by differences in nucleic acid sequences within the second ribosomal DNA Internal Transcribed Spacer region (ITS2). Analysis of additional specimens from different cyprinid hosts by molecular methods may be helpful to clarify the systematics of this fascinating family Diplozoidae.

Acknowledgment

The authors extend their thanks to the authorities of the Department of Zoology and Biotechnology, University of Kashmir for providing laboratory facilities. TAS is also highly thankful to Prof. Fayaz Ahmad for giving valuable suggestions while compiling this paper.

References

  1. Cunningham CO (1997) Species Variation within the Internal Transcribed Spacer (ITS) Region of Gyrodactylus (Monogenea: Gyrodactylidae) Ribosomal RNA Genes. The Journal of Parasitology 83: 215-219.
  2. Matejusova I, Gelnar M, McBeath AJA, Collins CM, Cunningham CO (2001a) Molecular markers for gyrodactylids (Gyrodactylidae: Monogenea) from five fish families (Teleostei). Int J Parasitol 31:738-745.
  3. Huyse T, Volckaert FAM (2002) Identification of host-associated species complex using molecular and morphometric analyses, with the description of Gyrodactylus rugiensoides n. sp. (Gyrodactylidae, Monogenea). Int J Parasitol32:907-919.
  4. Zietara MS, Huyse T, Lumme J, Volckaert FAM (2002) Deep divergence among subgenera of Gyrodactylus inferred from rDNA ITS region. Parasitology 124:39-52.
  5. Simkova A, Matejusova I, Cuningham CO (2006) Molecular phylogeny of the Dactylogyridaesensu.Kritsky&Boeger (Monogenea) using the D1-D3 domains of large ribosomal subunit rDNA. Parasitology 133:43-53.
  6. Matejusova I, Koubkova B, D’Amelio S, Cunningham CO (2001b) Genetic characterization of six species of diplozoids (Monogenea; Diplozoidae). Parasitology 123:465-474.
  7. Sicard M, Desmarais E, Lambert A (2001) Molecular characterisation of Diplozoidae populations on five Cyprinidae species: consequences for host specificity. CRAcadSci Paris, Sciences de la vie/Life Sciences 324:709-717.
  8. Matejusova I, Koubkova B, Gelnar M, Cunningham CO (2002) ParadiplozoonhomoionBychowsky&Nagibina, versus P. gracile Reichenbach-Klinke, (Monogenea): two species or phenotypic plasticity? SystParasitol 53:39-47.
  9. Sicard M, Desmarais E, Vigneux F, Shimazu T, Lambert A (2003) Molecular phylogeny of the Diplozoidae (Monogenea, Polyopisthocotylea) parasitizing 12 species of Cyprinadea (Teleostei): new data about speciation. Combes C, Jourdane J. Taxonomy, ecology and evolution of metazoan parasites. Universitaires de Perpignan, Perpignanpp. 199-211.
  10. Matejusova I, Koubkova B, Cunningham CO (2004) Identification of European diplozoids (Monogenea, Diplozoinae) by restriction digestion of ribosomal RNA internal transcribed spacer. J Parasitol 90:817-822.
  11. Gao Q, Chen MX, Yao WJ, Gao Y, Song Y, et al.(2007). Phylogeny of diplozoids in five genera of the subfamily Diplozoinae Palombi, as inferred from ITS-2 rDNA sequences. Parasitology 134:695-703.
  12. Jiang NCH, Wu BH, Wang SX (1985) Four new species of parasitic Diplozoon from freshwater fishes of the subfamily Gobioninae. ActaZootaxonomicaSinica 10:239-245.
  13. Kritscher E (1991) Diplozoon bileki nov. spec. (Plathelhminthes: Monogenea: Diplozoidae), einneuesDoppeltier von den Kiemen von Barbus plebejuseuboicus Stephanidis, (Pisces: Cyprinidae), gesammelt auf der InselEuba (Grienchenland). Annalen des Naturhistorischen Museum in Wien, Serie B Botanik und Zoologie 92:251-255.
  14. Blair D, Barker SC (1993) Affinities of the Gyliauchenidae: Utility of the 18S rRNA gene for phylogenetic inference in the digenea (Platyhelminthes). International journal for Parasitology23: 527-532.
  15. Cunningham CO, McGillivray DM, Mackenzie K (1995) Phylogenetic analysis of Gyrodactylus salariesMalmberg, based on the small subunit 18S ribosomal RNA gene. Molecular and Biochemical Parasitology 71: 139-142.
  16. Zhu X, Gasser RB, Chilton NB (1998) Differences in the 5.8S rDNA sequences among ascarid nematodes. International Journal for Parasitology 28:617-622.
  17. Fayaz A, Chishti MZ (1999) Fish Trematode Parasites of Kashmir. Genus DiplozoonNordmann, (Monogenea, Polyophisthocotylea) Orient Sci 4: 79-91.
  18. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,New York.
  19. Cable J, Harris PD, Tinsley RC, Lazarus CM (1999) Phylogenetic analysis of Gryrodactylus spp. (Platyhelminthes: Monogenea) using ribosomal DNA sequences. Canadian Journal of Zoology 77: 1439-1449.
  20. Desdevises Y, Jovelin R, Jousson O, Morand S (2000) Comparision of ribosomal DNA sequences of Lamellodiscus spp. (Monogenea, Diplectanidae) parasiting Pagellus (Sparidae, Telostei) in the North Mediterranean Sea: species divergence and coevolutionary interactions. International Journal for Parasitology 30: 741-746.
  21. Yildirim YB, Zeren A, Genc E, Erol C, Konas E (2010) Parasitological investigation on commercially important fish and crustacean species collected from the TIGEM (Dortyol Turkey) ponds. J AnimVet Adv 9:1597-1602.
  22. Lambert A, Le Brun N (1988) Hypothesesurl’originebiogeographique de Diplozoon (Monogenea, Polyopisthocotylea). Ann Parasit Hum Comp 63:99-102.
  23. Bakshi SA (1999) Fish parasites of some lakes of Kashmir with an analysis of seasonality of incidence and their maturation with regard to different ecological factors. Doctoral Thesis, University of Kashmir, India.
Citation: Ahmad F, Fazili KM, Sofi TA, Sheikh BA, Waza AA (2015) Morphological and Molecular Characterization of Diplozoon kashmirensis; D. aegyptensis and D. guptai Collected from Fishes of Kashmir Valley-India. Fish Aquac J 6:147.

Copyright: © 2015 Ahmad F, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Top