Journal of Clinical & Experimental Dermatology Research

Journal of Clinical & Experimental Dermatology Research
Open Access

ISSN: 2155-9554

Research Article - (2010) Volume 1, Issue 1

Filaggrin Mutations are Associated with Ichthyosis Vulgaris in the Southern Chinese Population

Chang-Xing Li1, Quan Luo2, Xue-Mei Li2, Xi-Bao Zhang2*, Chun-Lei Han1, Ze-Lin Ma1 and Dong-Zi Lin1
1Department of Dermatology, Dongguan Institute of Dermatology, NO. 216 Dongcheng West Road, Dongguan Guangdong, 523008, PR China
2Department of Dermatology, 1, NO. 56 Hengfu Road, Guangzhou 510095, PR China
*Corresponding Author: Xi-Bao Zhang, Department of Dermatology, Guangzhou Institute of Dermatology, Guangzhou 510095, PR China, Tel: 00 86 20 83592507, Fax: 008620 83587058 Email:

Received Date: Jan 01, 1970 / Accepted Date: Jan 01, 1970 / Published Date: Jan 01, 1970

Abstract

Background: Filaggrin (FLG) plays an important role in the epidermal barrier function, which identi fi ed in patients with ichthyosis vulgaris (IV).
Objective: To study the genetics of FLG mutations in Southern Chinese patients with IV.
Methods: We evaluated the in fl uence of fi ve mutations (3321 delA, 441delA, 1249 insG, E1795X and S3296X) in a cohort of 65 IV Chinese patients and in 100 control individuals using the Sequenom® MassARRAY® system.
Results: The null allele frequency of 3321delA was 52.31 % (34/65). FLG mutation 441delA was only found in one IV patients. FLG mutations 1249insG, E1795X and S3296X were not found in these patients.
Conclusions: These fi ndings show that the mutation 3321delA represent the most frequent genetic cause in Southern Chinese IV patients. Our fi ndings con fi rm and extend the knowledge of the in fl uence of FLG mutations in IV.

<

Keywords: Ichthyosis vulgaris; Southern chinese population; Filaggrin; Mutations; Polymorphism

Introduction

IV (OMIM 146700) is the most common ichthyosis with an estimated prevalence of 1:250–1000, and is inherited in a semidominant pattern [1]. Patients have light grey scaling, keratosis pilaris, increased palmoplantar markings and associated atopic manifestations. Involvement is generally mild and may vary greatly with climate and humidity. There is reduced or absence of keratohyalin granules in the epidermis. [2] In addition, there is a decrease or absence of profilaggrin, a major component of keratohyalin granules [3,4].

FLG is coding gene is located in the epidermal differentiation complex on chromosome 1q21 [5]. Recently, mutations in the FLG have been shown to be a major risk factor for IV and atopic dermatitis (AD) [5,6]. The association of FLG mutations with IV in Northern European, Japanese, Bangladeshi, Korean, Taiwanese and Singaporean Chinese populations and has been confirmed in subsequent studies [7-17]. To date, more than different 20 mutations have been identified in different populations, all leading to a filaggrin deficiency. FLG mutations 3321delA, 441delA, 1249insG, E1795X and S3296X have been previously reported, from Asia including China, Japan, Korea, Taiwan [8]. In this study, we identified five FLG mutations 3321delA, 441delA, 1249 insG, E1795X and S3296X in Southern Chinese IV patients.

Materials and Methods

Cases and controls

DNA samples from 65 IV were of Southern China origin and were recruited with ethical approval and had given their informed consent. The study was conducted according to the principles of the Declaration of Helsinki and all applicable local regulations related to protection of human subjects. The institutional review boards of the respective institutions approved the study. DNA samples from 100 healthy volunteers were available to serve as controls.

Genotyping

Genomic DNA was extracted from peripheral blood using standard techniques. All SNPs were genotyped by MassARRAY™ system (Sequenom, San Diego, CA, http://www.sequenom.com/). The iPLEX™ assay was followed according to manufacturers instructions (http://www.sequenom.com/) using 10 ng of genomic DNA. The primer sequences are available upon request (primer sequences in Table 1).

Mutations Polymerase chain reaction primer 1 sequence Polymerase chain reaction primer 2 sequence Extension primer sequence
3321del E1795X 1249 insG 441 delA S3296X ACGTTGGATGATCAGCAGAGCCACCAAGAG ACGTTGGATGAGCACTGGAGGAAGACAAAG ACGTTGGATGGGCAAGCTTCATCTGCAGTC ACGTTGGATGCCCTCAAGTCTGGAAAGAAG ACGTTGGATGTGCATCATCCCATGAACAGG ACGTTGGATGACCTGGTAGATGAAAGACCC ACGTTGGATGATGGTGTCCTGACCCTCTTG ACGTTGGATGTGAATGTCCCTCACTGTCAC ACGTTGGATGTTCAGAACTAGATTCATGCC ACGTTGGATGTGTCTGCTGACTGCTGGTG TCCAGACCTTCCCCC TGTCTCGTGCCTGCT GCCTGACTACCGCTAG TCATGCCTTTTCCCCCC GTGTCTCTCTCCTGGACTT

Table 1: Primer Sequences for all 5 FLG mutations Using iPlex Chemistry on a MassARRAY Platform.

Statistical analysis

Genotype frequencies between cases and controls were using the the continuity-adjusted chi-square test. The reported P-values are the results of two-sided tests. P-values ≤0.05 were considered to be statistically significant. All computations have been performed using SAS software version 8.01.

Results

The assay showed good clusters and mass spectra (Figure 1 and Figure 2).The null allele frequency of FLG mutation 3321delA were 52.31%(34/65) and 4%(4/100) in cases and controls respectively. FLG mutation 441delA was only found in one IV patients. FLG mutation 441delA was not found in the controls. FLG mutations 1249insG, E1795X and S3296X were not found in these patients and contols. When comparing IV patients with controls, only 3321delA mutation showed a statistically significant association with IV (Χ2=49.1718, P<0.0001).

clinical-experimental-dermatology-research

Figure 1

clinical-experimental-dermatology-research

Figure 2

Discussion

IV and AD are relatively common heritable skin diseases. Lack of expression of the protein filaggrin has been shown to predispose to the development of IV and atopic eczema or dermatitis [5,16]. The filaggrin gene resides on human chromosome 1q21 within the epidermal differentiation complex, a region that also harbours genes for several other proteins that are important for the normal barrier function of the epidermis [5].

Recent studies showed that both diseases are closely related to loss-of-function mutations in the FLG . The homozygous or compound heterozygous loss-of-function mutations p.R501X and c.2282del4 in FLG have been identified in moderate or severe IV patients from Ireland, Scotland and the USA [5]. Meanwhile, c.3321delA mutation in FLG were identified as prevalent in Japanese and Korean IV and AD patients [7,17]. FLG mutation E1795X was identified in the Taiwanese population [14]. Nonsense FLG mutations (p.S2889X and p.S3296X) were found in Japan [18]. Recent reports have suggested FLG mutations 1249insG, 7945delA, Q2147X E2422X and 441delA were found in Singaporean Chinese IV patients [15].

In our case–control study, we investigated 3321delA, 441delA, 1249 insG, E1795X and S3296X mutations which associated with Asian IV patients. With our results, we demonstrate here that more than 52.31% of IV patients in our Southern Chinese case series carry one FLG mutation 3321delA, whereas 4% of ethnically matched control individuals carry this mutation. Mutation 3321delA was firstly reported in a Japanese population [7], and was absent in the European population and Singaporean Chinese patients [8,15]. One mutation, 441delA, was a previously unidentified FLG mutation which might be Singaporean Chinese specific [15]. FLG mutation 441delA was only found in one IV patients in our case–control study. This mutation may be less common in the Asian populations. FLG mutations 1249 insG, E1795X and S3296X were not identified either in patients with IV or in healthy controls. With our results, we could not only confirm the strong influence of the FLG mutations on the pathogenesis of the disease in this population, but also exemplify differences in prevalent genetics of FLG mutations between Europe and Asia.

References

  1. Wells RS, Kerr CB (1965) Genetic classification of ichthyosis. Arch Dermatol 92: 1-6.
  2. Anton-Lamprecht I, Hofbauer M (1972) Ultrastructural distinctive features of autosomal dominant ichthyosis vulgaris and X-linked recessive ichthyosis. Dermatologica 145: 60-64.
  3. Sybert VP, Dale BA, Holbrook KA (1985) Ichthyosis vulgaris: identification of a defect in synthesis of filaggrin correlated with an absence of keratohyaline granules. J Invest Dermatol 84: 191-194.
  4. Nirunsuksiri W, Presland RB, Brumbaugh SG, Dale BA, Fleckman P (1995) Decreased profilaggrin expression in ichthyosis vulgaris is a result of selectively impaired posttranscriptional control. J Biol Chem 270: 871-876.
  5. Smith FJ, Irvine AD, Terron-Kwiatkowski A, Sandilands A, Campbell LE, et al. (2006) Loss-of-function mutations in the gene encoding filaggrin cause ichthyosis vulgaris. Nat Genet 38: 337-342.
  6. Bremmer SF, Hanifin JM, Simpson EL (2008) Clinical detection of ichthyosis vulgaris in an atopic dermatitis clinic: implications for allergic respiratory disease and prognosis. J Am Acad Dermatol 59: 72-78.
  7. Nomura T, Sandilands A, Akiyama M, Liao H, Evans AT, et al. (2007) Unique mutations in the filaggrin gene in Japanese patients with ichthyosis vulgaris and atopic dermatitis. J Allergy Clin Immunol 119: 434-440.
  8. Akiyama M (2010) FLG mutations in ichthyosis vulgaris and atopic eczema. spectrum of mutations and population genetics. Br J Dermatol 162: 472-477.
  9. Sandilands A, O’Regan GM, Liao H, Zhao Y, Terron-Kwiatkowski A, et al. (2006) Prevalent and rare mutations in the gene encoding filaggrin cause ichthyosis vulgaris and predispose individuals to atopic dermatitis. J Invest Dermatol 126: 1770-1775.
  10. Hamada T, Sandilands A, Fukuda S, Sakaguchi S, Ohyama B, et al. (2008) De novo occurrence of the filaggrin mutation p.R501X with prevalent mutation c.3321delA in a Japanese family with ichthyosis vulgaris complicated by atopic dermatitis. J Invest Dermatol 128: 1323-1325.
  11. Sandilands A, Terron-Kwiatkowski A, Hull PR, O’Regan GM, Clayton TH, et al. (2007) Comprehensive analysis of the gene encoding filaggrin uncovers prevalent and rare mutations in ichthyosis vulgaris and atopic eczema. Nat Genet 39: 650- 654.
  12. Gruber R, Janecke AR, Fauth C, Utermann G, Fritsch PO, et al. (2006) Filaggrin mutations p.R501X and c.2282del4 in ichthyosis vulgaris. Eur J Hum Genet 15: 179-184.
  13. Sinclair C, O’Toole EA, Paige D, El Bashir H, Robinson J, et al. (2009) Filaggrin mutations are associated with ichthyosis vulgaris in the Bangladeshi population. Br J Dermatol 160: 1113-1115.
  14. Hsu CK, Akiyama M, Nemoto-Hasebe I, Nomura T, Sandilands A, et al. (2009) Analysis of Taiwanese ichthyosis vulgaris families further demonstrates differences in FLG mutations between European and Asian populations. Br J Dermatol 161: 448-451.
  15. Chen H, Ho JC, Sandilands A, Chan YC, Giam YC, et al. (2008) Unique and recurrent mutations in the filaggrin gene in Singaporean Chinese patients with ichthyosis vulgaris. J Invest Dermatol 128: 1669-1675.
  16. Palmer CN, Irvine AD, Terron-Kwiatkowski A, Zhao Y, Liao H, et al. (2006) Common lossof-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis. Nat Genet 38: 441-446.
  17. Kang TW, Lee JS, Oh SW, Kim SC (2009) Filaggrin Mutation c.3321delA in a Korean Patient with Ichthyosis Vulgaris and Atopic Dermatitis. Dermatology 218: 186-187.
  18. Nomura T, Akiyama M, Sandilands A, Nemoto-Hasebe I, Sakai K, et al. (2008) Specific filaggrin mutations cause ichthyosis vulgaris and are significantly associated with atopic dermatitis in Japan. J Invest Dermatol 128: 1436-1441.
Citation: C Li, Luo Q, Li XM, Zhang XB, Han CL, et al. (2010) Filaggrin Mutations are Associated with Ichthyosis Vulgaris in the Southern Chinese Population. J Clin Exp Dermatol 1:102.

Copyright: © 2010 C Li, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Top