Journal of Plant Biochemistry & Physiology

Journal of Plant Biochemistry & Physiology
Open Access

ISSN: 2329-9029

Research Article - (2018) Volume 6, Issue 4

EcoTILLING in Cochliobolus sativus Isolates Reveals Polymorphisms in the XYL1 and XYL2

Jawhar M1, Till BJ2, Albaterni A1, Skiheita A1, Arabi MIE1, Bakri Y1* and Mir Ali N1
1Molecular and Biotechnology Division, Atomic Energy Commission of Syria (AECS), Damascus, Syria
2Plant Breeding and Genetics Laboratory, FAO/IAEA, A-1400 Vienna, Austria
*Corresponding Author: Bakri Y, Molecular and Biotechnology Division, Atomic Energy Commission of Syria (AECS), PO Box 6091, Damascus, Syria, Tel: 00963112132580 Email:

Received Date: Jan 01, 1970 / Accepted Date: Jan 01, 1970 / Published Date: Jan 01, 1970

Keywords: EcoTILLING; Low-cost polymorphism discovery; Xylanase; Single-strand specific nuclease XYL1, XYL2; Cochliobolus sativus

Introduction

Xylanase (endo-1, 4-B-xylanases, EC 3.2.1.8) is a class of enzymes that are involved in the breaking down of hemicellulose. Nowadays, it has attracted special attention due to its potential applications in many processing industries [1]. In nature, plant pathogens use these and other enzymes to degrade plant cell walls. As such, characterization of xylanases and xylanase gene diversity has implications for plantpathogen interaction and disease control [2-4]. The ability to break down plant cell walls also has important applications for human endeavours such as in the paper making industry and more recently for the production of biofuels [5]. Although xylanases from eubacteria and archaebacteria have considerably higher temperature optima and stability than those of fungi, the amount of enzyme produced by these bacteria is comparatively lower than that produced by fungi [6-8].

Fungal plant pathogens are considered promising sources of cell wall-degrading enzymes [7-9]. The haploid fungus Cochliobolus sativus (anamorph Bipolaris sorokiniana), a necrotrophic cereal pathogen, has been shown to produce cell wall degrading enzymes (CWDEs) including xylanase [10]. Xylanases are likely to be particularly important CWDEs in interactions between C. sativus and barley plants [11]. Different types of xylanase genes XYL1 and XYL2 have been characterized in C. sativus [12]. which are code for typical members of glycoside (glycosyl) hydrolase family 11 [13].

Detecting variations at single nucleotide positions and small nucleotide insertions or deletions are considered to be the most common forms of genetic diversity in natural populations [8,11]. Haploytpe blocks of genetic variation caused by linkage disequilibrium can be detected in different species. While the nucleotide variation causative for observed phenotypic variation may be difficult to demonstrate experimentally, the genotype codes for the phenotype is a useful tool in the plant, animal, microbe, and medical sciences [14-17]. Substantially, identification of related haplotype blocks can serve to understanding of causative genetic variation.

EcoTILLING approach for rapid discovery of DNA polymorphisms has been widely used for evaluating plant genomes, and to a lesser extent in humans and animals [18]. It was an adaptation of the of TILLING (Targeting Induced Local Lesions IN Genomes) technique, allows high-throughput analyses of natural genetic diversity in populations [18,19]. In this method, a single-strand specific endonuclease extracted from celery (CEL I) is used to cleave DNA where there are mismatched bases in the DNA heteroduplexes of PCR products. Cleaved fragments observed by gel electrophoresis indicate the presence of nucleotide variations. Because cleavage reveals only heterozygous polymorphisms, a sample pooling strategy involving at least one reference DNA and one test DNA is commonly employed as a means of uncovering homozygous differences between two samples [20]. Experiments indicated that EcoTILLING is highly efficient for detecting genetic variations associated with target traits for crop improvement. Nieto et al. [21] found one haplotype consisting several grouped SNPs controlling virus susceptibility in a natural melon population. Many SNPs in a dozen genes were also identified in wild populations of Populus trichocarpa [22] and in the Musa gene pool [23]. Key SNPs in the brassica FAE1 gene were also detected and these may be exploited for finding new low erucic acid sources [24].

EcoTILLING involves PCR amplification of target gene regions and create heteroduplexed molecules where polymorphisms exist in the amplified DNA. Heteroduplexes are subjected to cleavage by incubation with single-strand-specific nucleases, and cleaved fragments could be observed by gel electrophoresis to indicate SNP and small indel variations. Since cleavage reveals only heterozygous polymorphisms, a sample pooling strategy involving at least one reference DNA and one test DNA is commonly employed as a means of uncovering homozygous differences between two samples [20]. With this method it is possible to group samples according to haplotype banding pattern. Identification of the nucleotide variation requires sequencing of only one member of each haplotype group, that can reduce costs of the assay. While many works have employed fluorescence detection to improve sensitivity and denaturing PAGE for base-pair resolution, lower cost methods can be employed. Single-strand-specific nucleases such as CEL I that nick a single mismatched region in the heteroduplex molecules, will eventually cleave both strands at the mismatch resulting in a double strand break that can be identified using conventional native agarose gel electrophoresis [25-27]. In addition to a low-cost readout platform, CEL I can be self-extracted from celery or mung beans making the entire procedure low-cost [28].

In the present study we established EcoTILLING in C. sativus to survey a panel of isolates for allelic variants in candidate genes implicated in regulating xylanase production. As a proof of principle, Jawhar et al. [29] developed this method for barley spot blotch pathogen (C. sativus) to survey a panel of 50 isolates for allelic variants in different candidate genes. This panel was previously phenotyped for variation in the production of xylanase [30]. We chose XYL1 and XYL2 as candidate genes because of their known functions in xylanase production in C. sativus. A correlation between haplotypes and xylanase activity was observed. This work shows the utility of a low-cost EcoTILLING strategy using self-extracted nuclease and agarose gel electrophoresis for detecting natural nucleotide variation in the xylanase genes of C. sativus isolates. Based on the wide use of EcoTILLING in plant genomes and the establishment of the method for C. sativus, we envision broad applicability of this approach for many fungi.

Materials and Methods

Fungal isolates

During 20 years, isolates of C. sativus were obtained from leaves of barley and wheat showing spot blotch symptoms. In previous works [31], 56 single spore isolates were isolated from a single colony under the microscope using a sterile glass needle. Each colony was then eventually transferred to Petri dishes containing potato dextrose agar (PDA, DIFCO, Detroit, MI. USA) with 13 mg/l kanamycin sulphate added after autoclaving, and incubated for 10 days, at 22 ± 1°C in the dark to allow mycelial growth and sporulation.

Xylanase production

A natural population of 56 C. sativus monosporic isolates selected on the basis of morphological, physiological and xylanase production criteria [29-31]. were used in this study. Xylanase was produced by submerged culture as described by Bailey et al. [32] using 1% birchwood xylan as the substrate. The xylan solution and the enzyme at appropriate dilution were incubated at 55°C for 5 minutes and the reducing sugars were determined by the dinitrosalicylic acid procedure [33], with xylose as the standard. The released xylose was measured spectrophotometrically at 540 nm. One unit (U) of xylanase activity was determined as the amount of enzyme releasing 1 μmol xylose/ml per minute under experimental conditions.

DNA extraction and primers design

Genomic DNAs were prepared according to standard protocol [34]. DNAs were evaluated for quality and quantity using a standard agarose gel assay as previously described [35]. Each sample was normalized to a concentration of 20 ng/μl in TE buffer. Sequences for XYL1 and XYL2 of C. sativus were downloaded from GenBank (Accession numbers AJ29724 and AJ303047, respectively) and aligned with each other and PCR primers specific for XYL1 or XYL2 were designed based on the genome sequence of XYL1 and XYL2 genes in C. sativus ND90 (GenBank:M2R232; Table 1) [35].

Primer name Forward primer sequence (5'-3') Reverse primer sequence (5'-3')
Xyla CCCCAGTATCATTTCATCCTGCGATTC TTGCGCCATCATCATGCTAGCTACTTC
Xylb CCCCAGTATCATTTCATCCTGCGATTC AAGTGCTATTGCGCCATCATCATGCTA
Xylc CCCAGTATCATTTCATCCTGCGATTCA TTGCGCCATCATCATGCTAGCTACTTC
Xyld TTTCATCCTGCGATTCAGGCTCAACTA AAGTGCTATTGCGCCATCATCATGCTA
Xyle CCCAGTATCATTTCATCCTGCGATTCA AAGTGCTATTGCGCCATCATCATGCTA
Xylf CCCCAGTATCATTTCATCCTGCGATTC AAGTGCTATTGCGCCATCATCATGCTA
Xylg CCCAGTATCATTTCATCCTGCGATTCA TTGCGCCATCATCATGCTAGCTACTTC
Xylh TTTCATCCTGCGATTCAGGCTCAACTA AAGTGCTATTGCGCCATCATCATGCTA
Xyli CCCAGTATCATTTCATCCTGCGATTCA AAGTGCTATTGCGCCATCATCATGCTA

Table 1: EcoTILLING primers designed for this study.

PCR amplification and heteroduplex formation

In a preliminary experiment, the genomic DNA from five to eight isolates was pooled and then the isolates evaluated separately in order to determine nucleotide variation between tested samples. The PCR reaction was performed according to Jawhar et al. [29] in a 20 μL reaction volume containing 1U AmpliTaq® DNA polymerase, 60 μM dNTPs, 75 ng of genomic DNA, and 1.0 μM primers in 1X PCR Buffer (1.5 mM MgCl2, 50 mM KCl, 10 mM Tris•HCl, pH 8.3 at RT). After an initial denaturing step at 94°C for 4 min, the DNA was amplified through 20 cycles consisting of denaturing at 94°C for 5 sec, annealing at 65°C for 1 min decreasing by 0.5°C per cycle, and extension at 72°C for 1 min. The samples were then subjected to an additional 30 cycles consisting of denaturing at 94°C for 5 sec, annealing at 55°C for 1 min, and extension at 72°C for 1 min, with a final extension of 5 min at 72°C. Denaturing and re-annealing step were included at the end of the PCR reaction (99°C for 10 min, followed by 70 cycles of 70°C for 20 s decreasing by 0.3°C per cycle) to allow the formation of heteroduplexes.

CELI digestion of the heteroduplexes and agarose gel electrophoresis detection

CELI digestion was carried out according to Till et al. [28] with some modifications. The formed heteroduplexes (20 μL) were mixed with 20 μL nuclease mixture, containing 6 μL CJE Buffer (10 mM Hepes, pH 7.5, 10 mM MgSO4, 10 mM KCL, 0.002% Triton X-100, and 0.2 μg/mL BSA); 2.4 μL crude celery juice extract (CJE) preparation, and 11.6 μL ultrapure water. The digestion was carried out at 45°C for 45 min followed by incubation on ice to stop the reaction, and 4 μL of 10 × gel loading buffer was added to each sample. The digested products were separated on 2% agarose gels with 1 × TAE buffer at 110 V for 50 min, stained in an ethidium bromide buffer for 15 min, and then visualized by Gel Doc XR (BioRad Laboratories, Inc.).

Genotyping and verification by sequencing

Differences among the digested fragments from various DNA pools were assessed visually by recording molecular weights of bands representing cleavage products. Isolates had the same band patterns were considered as the same genotype for haplotype grouping. The cleaved bands were purified using an Ultrafree-DA DNA extraction kit (Millipore, Bedford, MA, USA) and sequenced by the dye terminator method on an Analyzer (ABI 310, Perklin-elmer, Applied Biosystems, USA). The sequences were used to validate nucleotide polymorphisms and haplotype associations determined by EcoTILLING. Geneious Pro Software v 8.0 (Biomatters Ltd; http://www.geneious.com) [36] was applied for detecting SNPs between sample data and a reference sequence.

Results and Discussion

A C. sativus EcoTILLING strategy was developed for the evaluation of nucleotide diversity in xylanase genes (Figure 1). A key agent for precise polymorphism discovery was the development of genespecific primers. However, in our study, three of the nine designed primer pairs could amplified a single gene target (Table 1), and each unique fragment visible after enzymatic digestion and agarose gel electrophoresis was scored as a SNP. Previous works with human and polyploid bananas shows that false positive and negative error rates are approximately 5% [19,23]. Across the three amplicons a total of 7 different NPs were identified among the 56 isolates (Figure 2). The remaining primer combinations were not suitable for EcoTILLING due to miss-priming and single primer amplification as revealed in the primer testing experiments (data not shown).

plant-biochemistry-physiology-xylanase

Figure 1: Scheme for EcoTILLING Cochliobolus sativus isolated from barley leaves. Disease spots are isolated and passed through a single spore culture. Samples are phenotypically evaluated for xylanase activity and DNA prepared from each culture. Gene-specific primers are designed to target loci. PCR is performed followed by a denaturing and annealing step to create heteroduplexed amplicons in samples where polymorphisms exist. Amplicons are subjected to enzymatic mismatch cleavage and cleavage products visualized by agarose gel electrophoresis. Samples with the same banding pattern represent the same haplotype grouping.

plant-biochemistry-physiology-enzymatic

Figure 2: Enzymatic mismatch cleavage band patterns (A to D) in pools of C. sativus for testing primer pair Xylc and Xylf. M: molecular weight marker (HinfI; MBI Fermentas, York, UK).

Band patterns of different pools, the 56 C. sativus isolates were divided into four groups, namely, haplotype A, B, C and D (Figure 2). The major variations in band patterns were only considered for haplotype classification, whereas those with minor differences were disregarded. The obtained sequences consistently demonstrated target fragment sequences in the two genes of the same haplotype group, indicating that a relatively accurate SNP genotyping could be achieved in the target genes via the EcoTILLING technique using agarose gel electrophoresis.

Samples from each haplotype were subjected to Sanger sequencing to confirm the EcoTILLING data (Table 2). While checking the correlation between the haplotype detected by EcoTILLING and xylanase phenotype of those C. sativus isolates, four haplotypes can be observed (Figure 2; Table 3). This suggested that the haplotype based on band patterns of EcoTILLING analysis with agarose gel detection could well reflect the variation of the xylanase genes among C. sativus isolates.

Gene Position Reference Haplotype
    Allele A B C D
XYL1 244 A T A A T
  257 G G C G G
  295 CA CA GT G T
  301 A A T T A
  324 T T A T T
XYL2 411 C C T C G
  460 G G C T C

Table 2: Sequence comparison for target regions of the XYL1 and XYL2 genes between haplotypes (A, B, C and D) and reference C. sativus isolate ND908.

Isolate Xylanase (U/g) Haplotype Isolate Xylanase (U/g) Haplotype
Cs61 73 D Cs16 1100 A
Cs64 73 D Cs31 1200 A
Cs30 75 D Cs51 1200 A
Cs56 77 D Cs8 1253 A
Cs22 129 D Cs37 2630 C
Cs58 130 D Cs39 2700 C
Csl1 141 D Cs42 2720 C
Cs56 170 D Cs69 2800 C
Cs20 180 D Cs41 2900 C
Cs59 180 D Cs54 2900 C
Cs23 188 D Cs5 2950 C
Cs33 188 D Cs53 2950 C
Cs17 202 D Cs6 3398 C
Cs57 203 D Cs9 3900 C
Cs24 206 D Csl 4095 B
Cs34 206 D Cs45 4200 B
Cs62 208 D Cs40 4900 B
Cs21 213 D Cs48 5330 B
Cs16 293 D Cs65 5400 B
Cs28 298 D Cs2 5403 B
Cs32 300 D Cs38 5710 B
Cs13 302 D Cs52 5750 B
Cs70 306 D Cs7 5824 B
Cs15 322 D Cs14 6130 B
Cs14 361 D Cs! 6171 B
Cs29 372 D Cs55 6300 B
Cs3 408 D Cs10 6365 B
Cs12 1099 A Cs50 6610 B
LSD (-0.05)          

Table 3: Association of xylanase production in C. sativus isolates, with haplotype groupings.

Enzymatic mismatch cleavage was previously shown to be highly sensitive allowing for the efficient discovery of heterozygous mutations in samples pooled up to eightfold [37]. We utilized this assay sensitivity to develop a strategy for the identification of all nucleotide polymorphisms in a haploid genome type by pooling samples prior to screening. Together, this allows for hypothesis testing of the evolutionary origin of nucleotide polymorphisms. To take advantage of agarose gel detection, special attention must be given to the quality and quantity of PCR products. First, it is important that a single specific product is obtained from a PCR reaction since the presence of nonspecific products may lead to heteroduplex formation. Non-specific amplification would result in the detection of CEL I-cleaved products even in the control samples. Therefore, it is important that once a SNP is detected in a pool, the individuals of the pools be tested separately to confirm that the cleaved products are a result of heteroduplexes formed across members of the pool and not a result of non-specific amplification. Secondly, it is critical to have a high yield of the amplicon. Products at concentrations less than 5 ng/μl would not be detected on regular agarose gels.

The polymorphisms found for XYL1 and XYL2 readily revealed the SNPs/indels associated with differences in xylanase contents [38,39]. Thus, our results are consistent with other studies showing that SNPs/ indels in xylanase corresponded to loss of function of these genes in C.sativus [40,41]. Therefore, detecting new C. sativus isolates with high xylanase content genetic background in this study using EcoTILLING would be a very efficient method for augmenting xylanase genetic resources.

Differences of EcoTILLING patterns among the different isolates were easy to detect by agarose gel electrophoresis, which reflect the highest genetic diversity for the investigated genes in C. sativus. Our results are in agreement with those obtained by Arabi and Jawhar [31] who reported high genetic diversity among Syrian C. sativus isolates. Zhong and Steffenson [42] documented that the diversity among this pathogen isolates may be due to their deriving from the same source population or transporting from area to another by their hosts.

On the other hand, the EcoTILLING used in this study, compares favorably to the most common alternative–full sequencing. For polymorphism discovery in populations of haploid such fungi, the frequency of haplotypes will determine which of the most advantages, and longer ratios of haplotypes to sampled isolates favor sequencing. With many fewer haplotype than isolates, EcoTILLING greatly reduces the number of sequences that needs to be determined. Further, this method is several fold cheap than full sequencing.

This study demonstrates that low-cost EcoTILLING based on selfextracted nucleases and agarose gel electrophoresis has been successfully adapted for detecting natural polymorphisms in XYL1 and XYL2 genes C. sativus population. These polymorphisms genes allowed grouping of fungi isolated from barley leaves into four haplotypes, which were associated with different xylanase production. EcoTILLING is shown to be a fast, convenient, and effective method for detecting SNPs in genes of haploid species, such as fungus. The method has been widely adapted for many crop species [43-45]. Having established EcoTILLING for C. sativus, we expect that it can be similarly adapted for many microorganisms. Moreover, this accurate and robust screening and molecular diagnostic of fungal isolates with high enzymatic activity will be essential for development of applications of industrial enzymes, that can transform agriculture and healthcare, use renewable resources to bring greater efficiency into industrial processes, check environmental degradation and deliver a more bio-based economy.

Acknowledgments

The authors would like to thank the Director General of AECS and the Head of Molecular Biology and Biotechnology Department for their support. They would also like to thank the Food and Agriculture Organization of the United Nations and the International Atomic Energy Agency through their Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture for supporting the laboratory experiments.

Conflict of Interest

The authors declare that they have no conflicts of interest to this work.

Ethical Statements

The authors declare that this work has not been published in whole or in part elsewhere; and that appropriate attribution and citation is given for any material reproduced from any other source including the authors’ prior publications.

References

  1. Malhotra G,  Chapadgaonkar SS (2018) Production and applications of xylanases-an overview. Biotechnologia 9: 59-72.
  2. Sunna A, Bergquist PL (2003) A gene encoding a novel extremely thermostable 1,4-ß-xylanase isolated directly from an environmental DNA sample. Extremophiles 7: 63-70.
  3. Douaiher MN, Nowak E, Durand R, Halama P, Reignault PH (2007) Correlative analysis of Mycosphaerella graminicola pathogenicity and cell wall-degrading enzymes produced in vitro: the importance of xylanase and polygalacturonase. Plant Pathol 56: 79-86.
  4. Bae JY, Laplaza J, Jeffries TW (2008) Effects of gene orientation and use of multiple promoters on the expression of XYL1 and XYL2 in Saccharomyces cerevisiae. Appl Bioch Biotech 145: 69-78.
  5. Motta FL, Andrade CCP, Santana MA (2013) A review of xylanase production by the fermentation of xylan: classification, characterization and applications. Genetics and Molecular Biology: Sustainable Degradation of Lignocelluloses Biomass-Techniques, Applications and Commercialization.
  6. Avguštin G, Flint HJ, Whitehead TR (1992) Distribution of xylanase genes and enzymes among strains of Prevotella (Bacteroides) ruminicola from the rumen. FEMS Microbiology Lett 99: 137-143.
  7. Haltrich D, Nidetzky B, Kulbe KD, Steiner W, Zupaneie S (1996) Production of fungal xylanases. Biore Technol 58: 137-161.
  8. Zhang S, He Y, Yu H, Dong Z (2014) Seven N-Terminal residues of a thermophilic xylanase are sufficient to confer thermostability on its mesophilic counterpart. PLoS ONE 9: e-87632.
  9. Kimura T, Mizutani T, Tanaka T, Koyama T, Sakka K, et al. (2003) Molecular breeding of transgenic rice expressing a xylanase domain of the xynA gene from Clostridium thermocellum. Appl Microb Biotech 62: 374-379.
  10. Karjalainen R, Peltones S, Kajander O, Niku-Paavolr MLN (1992) Production and characterization of xylanase from a phytopathogenic fungus Bipolaris sorokiniana. In: Visser J (ed.), Xylans and xylanases. Elsevier Science Publishers, Amsterdam, pp: 529-533.
  11. Kumar J, Schafer P, Huckelhoven R, Langen G, Baltruschat H, et al. (2002) Bipolaris sorokiniana, a cereal pathogen of global concern: cytological and molecular approaches towards better control. Mol Plant Pathol 3: 185-195.
  12. Emami K, Hack E (2001) Characterization of a xylanase gene from Cochliobolus sativus and its expression. Mycol Res 105: 352-359.
  13. Henrissat B, Bairoch A (1993) New families in the classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem J 293: 781-788
  14. Haseneyer G, Stracke S, Piepho HP, Sauer S, Geiger HH, et al. (2010) DNA polymorphisms and haplotype patterns of transcription factors involved in barley endosperm development are associated with key agronomic traits. BMC Plant Biol 10: 5.
  15. Su C, Khan A, Zhou P, Majumdar D, Aizenberg D, et al. (2012) Globally diverse Toxoplasma gondii isolates comprise six major clades originating from a small number of distinct ancestral lineages. Proceedings of the National Academy of Sciences of the United States of America 109: 15.
  16. Dong Z, Yang Y, Li Y, Zhang K, Lou H, et al. (2013) Haplotype variation of Glu-D1 locus and the origin of Glu-D1d allele conferring superior end-use qualities in common wheat. PLoS ONE 30: 9.
  17. Agler C, Nielsen DM, Urkasemsin G, Singleton A, Tonomura N, et al. (2014) Canine Hereditary Ataxia in Old English Sheepdogs and Gordon Setters Is Associated with a Defect in the Autophagy Gene Encoding RAB24. PLoS Genet 10: e1003991
  18. Colbert T, Till BJ, Tompa R, Reynolds S, Steine MN, et al. (2001) High-throughput screening for induced point mutations. Plant Physiol 126: 480-484.
  19. Till BJ (2014) Mining genetic resources via Ecotilling. In: Tuberosa R, Graner A, Frison E (eds.). Genomics of Plant Genetic Resources, Springer, Netherlands, pp: 349-365.
  20. Hofinger JB, Huynh OA, Jankowicz-Cieslak J, Muller A (2013) Validation of doubled haploid plants by enzymatic mismatch cleavage. Plant Methods 9: 43.
  21. Nieto C, Piron F, Dalmais M, Marco CF, Moriones E, et al. (2007) Ecotilling for the identification of allelic variants of melon eIF4E, a factor that controls virus susceptibility. BMC Plant Biol 7: 34.
  22. Gilchrist EJ, Haughn GW, Ying CC, Otto SP, Zhuang J, et al. (2006) Use of Ecotilling as an efficient SNP discovery tool to survey genetic variation in wild populations of Populus trichocarpa. Mol Ecol15: 1367-1378.
  23. Till BJ, Jankowicz-Cieslak J, Sagi L, Huynh OA, Utsushi H, et al. (2010) Discovery of nucleotide polymorphisms in the Musa gene pool by Ecotilling. Theor Appl Genet 121: 1381-1389.
  24. Wang N, Shi L, Tian F, Ning H, Wu X, et al. (2010) Assessment of FAE1 polymorphisms in three Brassica species using Ecotilling and their association with differences in seed erucic acid contents. BMC Plant Biol 10: 137-147.
  25. Chen L, Wang SO, Hu YG (2011) Detection of SNPs in theVRN-A1 gene of common wheat (Triticum aestivum L.) by a modified Ecotilling method using agarose gel electrophoresis. Australian J Crop Sci 3: 321-329.
  26. Garvin MR, Gharrett AJ (2007) Ecotilling: an inexpensive method for SNP discovery that reduces ascertainment bias. Mol Ecol Not 7: 735-746.
  27. Raghavan C, Naredo MEB, Wang HH, Atienza G, Liu B, et al. (2007) Rapid method for detecting SNPs on agarose gels and its application in candidate gene mapping. Mol Breed 19: 87-101.
  28. Till BJ, Zerr T, Comai L, Henikoff S (2006) A protocol for Tilling and Ecotilling in plants and animals. Nature Prot 1: 2465-2477.
  29. Jawhar M, Till BJ, Albaterni A, Skiheita A, Arabi MIE, et al. (2017) Optimizing Ecotilling technique for tracking field Cochliobolus sativus population. J Plant Pathol 99: 339-345.
  30. Bakri Y, Jawhar M, Arabi MIE (2009) Correlative analysis of Cochliobolus sativus pathogenicity and in vitro xylanase activity. J Phytopathol 158: 444-447.
  31. Arabi MIE, Jawhar M (2004) Identification of Cochliobolus sativus (spot blotch) isolates expressing differential virulence on barley genotypes in Syria. J Phytopathol 152: 461-464.
  32. Bailey MJ, Bailey P, Poutanen R (1992) Interlaboratory testing of methods for assay of xylanase activity. J Biotechnol 23: 257-270.
  33. Miller GL (1959) Use of dinitrosalicylic acid reagent for determination of reducing sugars. J Anal Chem 31: 426-428.
  34. Leach J, Finkelstein DB, Rambosek JA (1986) Rapid miniprep of DNA from filamentous fungi. Fungal Gen Newsl 33: 32-33.
  35. Till BJ, Zerr T, Comai L, Henikoff S (2006) A protocol for Tilling and Ecotilling in plants and animals. Nature Prot 1: 2465-2477.
  36. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, et al. (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647-1649.
  37. Greene EA, Codomo CA, Taylor NE, Henikoff JG, Till BJ, et al. (2003) Spectrum of chemically induced mutations from a large-scale reverse-genetic screen in Arabidopsis. Genet 164:731-740.
  38. Walfridsson M, Anderlund M, Bao X, Hahn-Hägerdal B (1997) Expression of different levels of enzymes from the Pichia stipitis XYL1 and XYL2 genes in Saccharomyces cerevisiae and its effects on product formation during xylose utilization. Appl Microb Biotech 48: 218-224.
  39. Emami K, Hack E (2002) Conservation of XYN11A and XYN11B xylanase genes in Bipolaris sorghicola, Cochliobolus sativus, Cochliobolus heterostrophus, and Cochliobolus spicifer.Curr Microb 4: 303-306.
  40. Karjalainen R, Peltones S, Kajander O, Niku-Paavolr MLN (1992) Production and characterization of xylanase from a phytopathogenic fungus Bipolaris sorokiniana. In: Visser J (ed.), Xylans and xylanases. Elsevier Science Publishers, Amsterdam, pp: 529-533.
  41. Emami K, Hack E (2001) Characterization of a xylanase gene from Cochliobolus sativus and its expression. Mycol Res 105: 352-359.
  42. Zhong S, Steffenson BJ (2001) Virulence and molecular diversity in Cochliobolus sativus. Phytopathology 91: 469-476.
  43. Wang N, Shi L, Tian F, Ning H, Wu X, et al. (2010) Assessment of FAE1 polymorphisms in three Brassica species using Ecotilling and their association with differences in seed erucic acid contents. BMC Plant Biol 10: 137-147.
  44. Frerichmann LMS, Kirchhoff M, Müller AE, Scheidig AJ, Jung C, et al. (2013) Ecotilling in Beta vulgaris reveals polymorphisms in the FLC-like gene BvFL1 that are associated with annularity and winter hardiness. BMC Plant Biol 13: 52.
  45. Sabetta W, Blanco A, Zelasco S, Lombardo L, Perri E, et al. (2013) Fad7 gene identification and fatty acid phenotyic variation in an olive collection by Ecotilling and sequencing approaches. Plant Physiol Biochem 69: 1-8.
Citation: Jawhar M, Till BJ, Albaterni A, Skiheita A, Arabi MIE, et al. (2018) EcoTILLING in Cochliobolus sativus Isolates Reveals Polymorphisms in the XYL1 and XYL2. J Plant Biochem Physiol 6:225.

Copyright: © 2018 Jawhar M, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Top