Endocrinology & Metabolic Syndrome

Endocrinology & Metabolic Syndrome
Open Access

ISSN: 2161-1017

Research Article - (2014) Volume 0, Issue 0

Does 11β-HSD1 Associate with the Development of Visceral Adiposity in Maternal Mg Restricted Wistar/NIN Rat Offspring?

Kalashikam Rajender Rao1,2*, Lagishetty Venu2, Inagadapa Padmavathi2,3 and Manchala Raghunath2
1National Center for Laboratory Animal Sciences, India
2Division of Endocrinology and Metabolism, National Institute of Nutrition, Hyderabad, India
3 Department of Orthopaedic Surgery, David Geffen School of Medicine, University of California, Los Angeles, California, USA
*Corresponding Author: Kalashikam Rajender Rao, National Center for Laboratory Animal sciences, National Institute of Nutrition, Jamai Osmania P O, Hyderabad - 500 007, India, Tel: +91-40-27197343, Fax: +91-40-27019074 Email:

Published Date: Jan 01, 1970

Abstract

Maternal magnesium restriction irreversibly increased body fat %, specially the visceral adiposity in WNIN rat offspring. We have now investigated whether the increased visceral adiposity was associated with increased adipogenesis and glucocorticoid stress. Female, weanling WNIN rats were fed for 12 weeks, a control (AIN 93G) diet (MgC) or the same with 70% restriction of Mg (MgR) and mated with control males. Some of the pregnant MgR dams were rehabilitated from parturition and their pups weaned on to control diet (MgRP). At weaning half of the pups from MgR dams were shifted to control diet (MgRW) while the other half continued on Mg restriction (MgR). mRNA expression for fatty acid synthase (FAS) and 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) was significantly higher in MgR adipose tissue offspring. However leptin mRNA expression was comparable among different groups. Both the rehabilitation regimes corrected the expression of 11β-HSD1 but not that of FAS. Maternal Mg restriction predisposed the offspring to increased glucocorticoid stress (11β-HSD1) that could underlie the increased body fat %/central adiposity.

Keywords: Magnesium; 11β-HSD1; Maternal under-nutrition; Fatty acid synthase; Visceral adiposity

Background

Adverse intrauterine environment predisposes the offspring to metabolic syndrome in adult life [1,2]. We showed earlier that maternal micronutrient (mineral and vitamin) restriction in WNIN rats increased the body fat%, altered plasma lipid and insulin levels and was associated with altered oxidative stress and adipocytokine levels in offspring suggesting that micronutrients were important in developmental programming of adiposity in the offspring [3,4]. Available literature suggests that modulation of epigenetics and stress (glucocorticoid and/or oxidative) could be some common pathways involved in developmental programming for adult diseases in the offspring due to maternal malnutrition during pregnancy and/or lactation [5,6]. High glucocorticoid stress as evident from 11β-HSD1 over expression is known to regulate adipose tissue differentiation, function, distribution and cause visceral adiposity, insulin resistance [7,8] and further 11β-HSD1 acts at the interface of inflammation and obesity [9]. Magnesium is important in the structure and function of the cell and is involved in more than 300 essential metabolic reactions. Epidemiological studies have shown that Mg deficiency resulted in the development of inflammation and was strongly associated with cardiovascular disease risk [10,11]. We recently showed that Mg restriction in utero predisposed the rat offspring to long term adiposity, specially visceral adiposity [12,13] and the offspring had increased expression (protein) of fatty acid synthase (FAS) and decreased leptin expression in adipose tissue [13]. This study aimed to determine whether or not altered mRNA expression (transcriptional regulation) underlies the changes in 11β-HSD1, FAS and leptin expression vis-avis visceral adiposity in the offspring of Mg restricted WNIN rat dams.

Materials and Methods

Study design

Female, weanling WNIN rats (n = 28) were obtained from National Center for Laboratory Animal Sciences, National Institute of Nutrition (Hyderabad, India). The animal experimental procedure was approved by the “Institute’s ethical committee on animal experiments” at National Institute of Nutrition, Hyderabad, India. They were housed individually in polypropylene cages with wire mesh bottom and maintained under standard lighting conditions (12-hour light/dark cycle). The animal feeding and experimental protocol for this study has been described by us earlier [12]. Briefly, a group of 21 rats was fed a basal diet (AIN-93G) containing 165 mg of Mg/kg diet (Mg restricted-MgR) for 12 weeks. The other group of seven rats received the control diet containing 650 mg of Mg/kg diet (Mg control-MgC). Rats were mated with control males and maintained on their respective diets throughout pregnancy. A subgroup (n = 7) of MgR dams was shifted to control diet on the day of parturition and their offspring from weaning (Mg rehabilitated from parturition-MgRP). At the time of weaning half the number of MgR pups were weaned on to control diet (Mg rehabilitated from weaning - MgRW) and the remaining half of the MgR pups continued on Mg restricted diet. The offspring (male) were continued on their respective diets till the time of sacrifice (18 months of age).

Gene expression analysis

Adipose tissue (retroperitoneal) was collected from different groups of offspring at the time of their sacrifice, frozen immediately and stored at - 80°C for molecular studies. Total RNA was isolated from ~ 100 mg of the frozen tissue by TRIzol reagent according to manufacturer’s instructions (Invitrogen Life technologies, Carlsbad, CA). 2 μg of total RNA was used to synthesize cDNA using Invitrogen kit (Invitrogen Life technologies, Carlsbad, CA). The primer sequences for 11β-HSD1, leptin, fatty acid synthase (Fasn) and 18S rRNA were shown in table 1. The expressions of different genes were analyzed by semi-quantitative PCR. The PCR products were resolved electrophoretically on 1.2% agarose gel pre-stained with ethidium bromide. The quantitative expression of the genes was analyzed by Quantity One software (Bio- Rad Laboratories, Herculus, CA).

Gene Name Accession No Forward Primer (5’-3’) Reverse primer (5’-3’)
11b-HSD1 NM 017080.2 CTCTTGGGTGGACTGGACAT TGCTCAGGACCACATAGCTG
leptin NM 013076 GAGACCTCCTCCATCTGCTG CATTCAGGGCTAAGGTCCAA
Fasn NM 017332 TCGAGACACATCGTTTGAGC TCAAAAAGTGCATCCAGCAG
18S rRNA M 11188.1 CCAGAGCGAAAGCATTTGCCAAGA AATCAACGCAAGCTTATGACCCGC

Table 1: Accession numbers and primer sequences of different genes.

Statistical analysis

The values were presented as means ± S.E. Data was analyzed using one-way ANOVA followed by the multiple range test or least significant difference method. Wherever heterogeneity of variance was observed, differences between groups were tested using non-parametric Mann- Whitney U test. The differences were considered significant only if p was < 0.05.

Results

Fatty acid synthase mRNA expression

The mRNA expression of fatty acid synthase was significantly increased in MgR compared to MgC offspring and this result was not corrected by either of the rehabilitation regimes (Figure 1).

endocrinology-metabolic-syndrome-Distribution-Pattern

Figure 1: Effect of maternal Mg restriction and rehabilitation on expression of genes by semi-quantitative PCR in the adipose tissue of the offspring (at 18 months of age); white bars = MgC (control) group, black bars = MgR (Mg restriction) group, horizontal dotted bars = MgRP (Mg rehabilitation from parturition) group, diagonal stripe bars = MgRW (Mg rehabilitation from weaning). Gel picture for each gene is the representation of different groups. Values are mean + SE (n=6). Bars without a common superscript ‘a’ and ‘b’ are significantly different at p< 0.05 by one way ANOVA & Post Hoc LSD.

11β-HSD1 mRNA expression

The mRNA expression of 11β-HSD1 was significantly upregulated in MgR offspring compared to controls. Interestingly, this change was restored to control levels by both the rehabilitation regimes (Figure 1).

Leptin mRNA expression

The expression of leptin mRNA was comparable among the different groups (Figure 1).

Discussion

Magnesium intake is important in maintaining intracellular Mg homeostasis and is hypothesized to be one of the common antecedents for the pathogenesis of insulin resistance, type 2 diabetes, hypertension, and cardiovascular disease (CVD) [14,15]. Evidence from observational studies showed that dietary Mg intake was inversely correlated to the development of the adult diseases and its deficiency may promote inflammatory response [16]. We showed earlier that maternal Mg restriction increased the body fat %, specially the visceral adiposity in WNIN rat offspring and was associated with altered protein expression of fatty acid synthase (increased) and leptin (decreased) in the adipose tissue of the MgR offspring [12,13]. Altered expression of leptin and FAS proteins in adipose tissue has indeed been linked earlier to the development of visceral adiposity, obesity, insulin resistance and type 2 diabetes [17]. Considering these facts we deciphered whether the altered expression of the above proteins in the MgR offspring was at the transcriptional level and if yes determine the effects of rehabilitation. The significant over expression of fatty acid synthase mRNA in MgR offspring in the present study correlates with its increased protein expression reported by us earlier [13]. Taken together these results suggest maternal Mg restriction modulates FAS in the offspring at transcription and/or translation level and this may be responsible for the increased adiposity/central adiposity in the offspring. That the expression of FAS mRNA was not corrected by either of the rehabilitation regimes probably indicates the importance of Mg in maintaining fat metabolism throughout gestation and lactation.

Despite the decreased leptin protein expression observed earlier in the MgR offspring [13], there was no change in leptin mRNA expression in the present study. This probably suggests that modulation of leptin expression in MgR offspring may be at post transcriptional and/or translational level rather than at transcription. This observation is not in agreement with our finding that maternal Cr restriction increased the expression of leptin in the offspring at both transcription and translation levels [18]. Developmental programming of adult onset diseases in the offspring due to maternal under-nutrition appears to occur through some common pathways/mechanisms involving stress and epigenetic changes. The effects of maternal under-nutrition on fetal programming are reported to be regulated either by modulating the glucocorticoid stress and cortisol hormone [19] or through release of oxidative free radicals and/or decreased antioxidant defense mechanism. Our earlier reports showed that maternal Mg restriction did not induce oxidative stress in rat offspring [13] probably suggesting the importance of the glucocorticoid stress in the adiposity and insulin resistance in MgR rat offspring. Therefore we assessed the expression of 11β-HSD1 in the MgR offspring to understand the role if any of the glucocorticoid stress.

Interestingly there was elevated expression of 11β-HSD1 mRNA in the adipose tissue of MgR offspring indicating that maternal Mg restriction probably programs/increases glucocorticoid mediated stress in the offspring. This is in line with our similar observations in the offspring of chromium restricted WNIN rat dams [18] and increased levels of plasma cortisol in the offspring of folate and/or vitamin B12 restricted Wistar rats (unpublished observations). This finding assumes significance considering that mRNA over expression of 11β-HSD1 in adipose tissue has earlier been linked to adipogenesis [20] and 11β-HSD1 has been suggested to be the potent enzyme mediating the function of glucocorticoid to manifest adiposity and inflammation [21]. Our finding also suggests that increased expression of 11β-HSD1 in adipose tissue could be a probable contributing factor for the developmental programming of adiposity and insulin resistance in MgR rat offspring. That rehabilitation could mitigate the change in 11β-HSD1 reiterates the importance of Mg in modulating the corticosteroid stress and hence adiposity in the offspring.

Conclusions

In conclusion maternal Mg restriction triggers corticosteroid stress as evident from the overexpression of 11β-HSD1 which may activate adipose tissue differentiation and result in visceral adiposity. This further could alter fat metabolism as suggested by the elevated levels of FAS protein and mRNA. Whether the altered expression of these genes in MgR offspring is due to epigenetic changes however need to be deciphered.

Competing Interests

The authors declare that they have no competing interests.

Author’s Contributions

MR designed the project. LV conducted the animal experiment. IJNP and KRR analyzed and interpreted the data. KRR, IJNP and MR prepared the manuscript. All authors read and approved the final version of the manuscript to be submitted.

Acknowledgements

This work was supported by a research grant from the Department of Biotechnology, Government of India, New Delhi, India (Project No. BT /PR2832 / Med /14 /390 /2001).

References

  1. Yajnik CS (2004) Early life origins of insulin resistance and type 2 diabetes in India and other Asian countries. J Nutr134:205-210.
  2. Phillips DI, Barker DJ, Fall CH, Seckl JR, Whorwood CB, et al. (1998) Elevated plasma cortisol concentrations: a link between low birth weight and the insulin resistance syndrome? J Clin Endocrinol Metab 83:757-760.
  3. Venu L, Harishankar N, Krishna TP, Raghunath M (2004) Does maternal dietary mineral restriction per se predispose the offspring to insulin resistance? Eur J Endocrinol 151:287-294.
  4. Venu L, Harishankar N, Prasanna Krishna T, Raghunath M (2004) Maternal dietary vitamin restriction increases body fat content but not insulin resistance in WNIN rat offspring up to 6 months of age. Diabetologia 47:1493-1501.
  5. Burdge GC, Hanson MA, Slater-Jefferies JL, Lillycrop KA (2007) Epigenetic regulation of transcription: a mechanism for inducing variations in phenotype (fetal programming) by differences in nutrition during early life? Br J Nutr 97: 1036-1046.
  6. Hultman K, Alexanderson C, Mannerås L, Sandberg M, Holmäng A, et al. (2007) Maternal taurine supplementation in the late pregnant rat stimulates postnatal growth and induces obesity and insulin resistance in adult offspring. J Physiol 579:823-833.
  7. Kannisto K, Pietiläinen KH, Ehrenborg E, Rissanen A, Kaprio J, et al. (2004) Overexpression of 11beta-hydroxysteroid dehydrogenase-1 in adipose tissue is associated with acquired obesity and features of insulin resistance: studies in young adult monozygotic twins. J Clin Endocrinol Metab 89:4414-4421.
  8. Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, et al. (2001) A transgenic model of visceral obesity and the metabolic syndrome. Science 294:2166-2170.
  9. Staab CA, Maser E (2010) 11beta-Hydroxysteroid dehydrogenase type 1 is an important regulator at the interface of obesity and inflammation. J Steroid Biochem Mol Biol 119:56-72.
  10. Song Y, Ridker PM, Manson JE, Cook NR, Buring JE, et al. (2005) Magnesium intake, C-reactive protein, and the prevalence of metabolic syndrome in middle-aged and older U.S. women. Diabetes Care 28:1438-1444.
  11. Chacko SA, Song Y, Nathan L, Tinker L, de Boer IH, Tylavsky F, et al. (2010) Relations of dietary magnesium intake to biomarkers of inflammation and endothelial dysfunction in an ethnically diverse cohort of postmenopausal women. Diabetes Care 33: 304-310.
  12. Venu L, Kishore YD, Raghunath M (2005) Maternal and perinatal magnesium restriction predisposes rat pups to insulin resistance and glucose intolerance, J Nutr 135:1353-1358.
  13. Venu L, Padmavathi IJ, Kishore YD, Bhanu NV, Rao KR, et al. (2008) Long-term effects of maternal magnesium restriction on adiposity and insulin resistance in rat pups. Obesity (Silver Spring) 16:1270-1276.
  14. Barbagallo M, Dominguez LJ, Galioto A, Ferlisi A, Cani C, et al. (2003) Role of magnesium in insulin action, diabetes and cardio-metabolic syndrome X. Mol Aspects Med 24:39-52.
  15. Paolisso G, Barbagallo M (1997) Hypertension, diabetes mellitus, and insulin resistance: the role of intracellular magnesium. Am J Hypertens 10:346-355.
  16. Song Y, Li TY, van Dam RM, Manson JE, Hu FB (2007) Magnesium intake and plasma concentrations of markers of systemic inflammation and endothelial dysfunction in women, Am J Clin Nutr 85:1068-1074.
  17. Jazet IM, Pijl H, Meinders AE (2003) Adipose tissue as an endocrine organ: impact on insulin resistance. Neth J Med 61: 194-212.
  18. Padmavathi IJ, Rao KR, Venu L, Ganeshan M, Kumar KA, et al. (2010) Chronic maternal dietary chromium restriction modulates visceral adiposity: probable underlying mechanisms. Diabetes 59:98-104.
  19. Nyirenda MJ, Seckl JR (1998) Intrauterine events and the programming of adulthood disease: the role of fetal glucocorticoid exposure (Review). Int J Mol Med 2:607-614.
  20. Desbriere R, Vuaroqueaux V, Achard V, Boullu-Ciocca S, Labuhn M, et al. (2006) 11beta-hydroxysteroid dehydrogenase type 1 mRNA is increased in both visceral and subcutaneous adipose tissue of obese patients. Obesity (Silver Spring) 14:794-798.
  21. Draper N, Stewart PM (2005) 11beta-hydroxysteroid dehydrogenase and the pre-receptor regulation of corticosteroid hormone action. J Endocrinol 186:251-271.
Citation: Rajender Rao K, Padmavathi I, Venu L, Raghunath M (2012) Does 11β-HSD1 Associate with the Development of Visceral Adiposity in Maternal Mg Restricted Wistar/NIN Rat Offspring?. Endocrinol Metabol Syndrome S7:002.

Copyright: © 2012 Rajender Rao K, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Top