Journal of Pollution Effects & Control

Journal of Pollution Effects & Control
Open Access

ISSN: 2375-4397

Research Article - (2016) Volume 4, Issue 1

Detection of Extended Spectrum Beta-Lactamase Producing Escherichia Coli on Water at Hafr Al Batin, Saudi Arabia

Sulaiman Ali Al Yousef, Eman Saleh Farrag, Ahmed Mohamed Ali and Sabry Younis Mahmoud*
Department of Medical Laboratory Technology, College of Applied Medical Science, University of Hafr Al Batin, Kingdom of Saudi Arabia
*Corresponding Author: Sabry Younis Mahmoud, Department of Medical Laboratory Technology, College of Applied Medical Science, University of Hafr Al Batin, Kingdom of Saudi Arabia, Tel: +966506892734 Email:

Published Date: Jan 01, 1970

Abstract

In this study antibiotic resistant Escherichia coli from household water collected in Hafr AlBatin, Saudi Arabia, were characterized by prevalence of extended spectrum betalactamase (ESBL). Samples were collected from drinking and washing water at 12 locations. From the 144 samples obtained, Millipore membrane filters incubated on trypton soya agar plates produced colonies that yielded 34 isolates of E. coli as verified by biochemical tests. Isolates suspected ESBL producing were tested by using MicroScan analysis and disc diffusion test as ESBL phenotypic confirmatory methods. Phenotypically confirmed ESBL isolates were examined for antimicrobial susceptibility against 30 antibiotics and amplification of blaVEM, blaCTX, blaTEM, blaGES and blaSHV genes by polymerase chain reaction. Out of 34 E. coli isolates, only 6 (17.6%) were positive for ESBL producing according to MicroScan analysis. Disk diffusion as a confirmatory test indicates sensitivity of MicroScan system. PCR results indicated that the VEB was the most prevalent (83.3%) followed by CTX gene (16.6%) between these isolates. The ESBL-producing E. coli isolates was fully susceptible to pip/tazo (100%) and fully resistance to ampicillin, cefazolin and pepracillin (100%). This study showed that ESBL-producing E. coli are multidrug-resistant and existent in Hafr Al Batin’s water. Also, data indicated that wastewater maybe contributes as a source and reservoir of antibiotic resistance.

Keywords: Antimicrobial resistance; ESBL; E. coli; Water

Introduction

One of the major ways of diffusion of pathogenic and/or antibiotic resistant bacteria, through water, soil and air. Multidrug resistant bacteria have been revealed in different water sources including rivers, lakes, groundwater and drinking water [1-4]. Water consumption, can command to habitation of the gastrointestinal tract of humans and animals by bacteria containing resistance genes and barter genes with bacteria previously present in the intestinal tract [5,6].

Some bacteria can make beta-lactamase enzymes that cleave the beta-lactam ring and then disrupt the antimicrobial action [7]. An extended spectrum beta-lactamase (ESBL)-producing bacteria is capable to disrupt the third generation cephalosporins and monobactum [8]. Also, shown to be able to combat quinolones [9]. ESBL-producing bacteria especially of Enterobacteriaceae, foremost E. coli and Klebsiella pneumonia [10]. ESBL-producing E. coli have 3 various resistance mechanisms. The most widespread is production of beta-lactamase which hydrolyzes the beta-lactam ring in penicillins and cephalosporins. The second is mutation which decrease betalactam uptake [11]. The third resistance mechanism is existence of efflux pumps, which exports antibiotics outside of the cell.

Penicillins and concerned antibiotics have been utilized extensively for the control and treatment of bacterial infections. Efficiency of this group of antimicrobial agents has been amended, because of the evolution of multidrug-resistant strains of bacteria [13]. Through the years, incalculable penicillin derivatives [14] have been designed and tested, and a variety of new β-lactam ring systems have been introduced such as cephalosporins, cephamycins, oxacepems, clavulanic acid and carbapenems.

Saudi Arabia with an area of 2.15 million km2 is a desert and water deficit country, with limited fresh water-supplies. It is also recognized by low annual rainfall and privation perennial rivers. The water resources in the Saudi Arabia are surface and underground deposits. Water collected through rainfall (surface water).

In Hafr Al Batin city about 100% of water supply comes from groundwater. Water transported by car to the house where stored in the wells dedicated to it, which may be located next to the sewage tanks. No available information about extended-spectrum beta-lactamases (ESBLs) producing bacteria in water Hafr Al Batin. The present study was to gain insight into the prevalence of AMR E. coli in washing and drinking water, and to check the possible role of sewage tanks as AMR contamination source of water.

Materials and Methods

Water sampling

Water samples were taken from 12 locations in the Hafr Al-Batin city, Saudi Arabia (Figure 1). Three sampling sites were located on each location. Two of which were from washing water that taken from house tanks in most of residential neighborhoods and one from drinking water from charity refrigerators. Sampling was done twice, the first on January (winter) and the second on July (summer). Two samples were collected each time at each collection site at two different times, and we used three replicates from each sample for tests. Collected samples were transported by standard methods as mentioned in APHA, 1989 [15].

pollution-effects-study-area

Figure 1: Location map of the study area of Hafr Al-Batin city, Saudi Arabia.

Isolation of E. coli

100 mL water sample is filtered through 0.45 μm pore size membrane filters (Millipore, the Netherlands). Filters were incubated on tryptone soya agar (TSA) at 36 ± 2°C during 4-5 hours, and subsequently transferred to tryptone bile agar (TBA) then incubated for 19-20 hours at 44 ± 0.5°C as described by Sing et al. [16]. E. coli identified using the TSA/TBA method (i.e. indole-positive), were supplementary confirmed as E. coli by testing for ß-glucuronidase activity on Brilliance E. coli/coliform agar. Beta-glucuronidase-positive colonies identified using tryptone bile x-glucuronide agar (TBX) was extra confirmed by MicroScan [17] for identification and antibiotic susceptibility.

Analysis of antimicrobial resistance

Generally, 99 E. coli isolates (91 from washing water and 8 from drinking water) were obtained. These were screened for confirmation of identification and its susceptibility to a panel of antimicrobials of human and veterinary clinical relevance, using MicroScan. MicroScan® instrumentation (auto SCAN®-4 and WalkAway® System) (Siemens Healthcare Diagnostics Inc, USA) was used. Panels used were MicroScan Dried Gram Positive MIC/Combo, Dried Gram Positive Breakpoint Combo and Dried Gram Positive ID Type 2 or 3. Also, MicroScan Dried Gram Negative MIC/Combo panels and Dried Gram Negative Breakpoint Combo Panels were used. MicroScan panels were designed for use in determining agent susceptibility and/or identification to the species level of rapidly growing aerobic and facultative Gram positive cocci or aerobic and facultatively anaerobic Gram negative bacilli. MICs obtained for ceftazidime and cefotaxime with CA were compared with those obtained with the same drugs without CA. Subsequently, strains were considered as ESBL-positive or -negative in accordance with CLSI recommendations (CLSI, 2010). The tests were performed as recommended by supplier guidelines [17]. Susceptible, intermediate and resistant isolates were arranged according to antibiogram results. Multi-drug resistance was defined as resistance to 3 or more different classes of antimicrobials according to CLSI, 2010 [18].

Confirmation of ESBL-producing E. coli

Suspected ESBL-E. coli isolates (after MicroScan analysis) were confirmed for ESBL-production by double disc synergy test (DDST) according to CLSI guidelines (CLSI, 2010) [18]. DDS test results analysis. Susceptibility testing was performed (McFarland 0.5 standard) on Mueller–Hinton agar (MHA) by placing discs on the agar surface containing 30 mg cefotaxime or ceftazidime, with and without 10 mg CA. Plates were incubated at 37°C for 24 h. According to CLSI guidelines, strains were considered positive for ESBL production whenever zone diameters increased by ¢5 mm for cefotaxime or ceftazidime when tested in combination with CA. This method was considered the gold standard for method comparison.

DNA isolation and genotyping

A single colony from each ESBL-producing isolate was transferred into 100 μL of sterile distilled water and the bacterial DNA was extracted by using boiling method included microwave pre-heating according to Ahmed et al. [19]. PCR screening for presence of different beta-lactamase genes was performed. PCR was carried out and specific primers (Table 1) were used for VEB, CTX, TEM and GES genes. PCR mixtures were prepared by using 5 μL template DNA (about 500 pg of DNA), 12.5μL PCR master mix; 1 × PCR buffer [Tris-Cl, KCl, (NH4)2SO4, 1.5mM MgCl2] (pH 8.7), 200 μM dNTP, and 1 μL of each 10 pM primer and 0.5U Taq DNA polymerase in a final volume of 25 μL. The amplification reaction was carried out in a Thermal Cycler (Eppendorf master cycler®, MA) with an initial denaturation (94°C for five minutes) followed by 30 cycles of denaturation (94°C for 25 seconds) annealing (52°C for 40 seconds), and extension (72°C for 50 seconds) and a single final extension at 72°C for six minutes [20]. The amplified products were electrophoresed on 2% agarose gel and visualized on a gel document system after staining with ethidium bromide (0.5 mg/mL). A non-ESBLproducing strain (E. coli ATCC 25922) was used as a negative control.

Genes Primer used (5'-3') PCR product size
VEB CGACTTCCATTTCCCGATGC
GGACTCTGCAACAAATACGC
585 bp
CTX CAAAGAGAGTGCAACGGATG
ATTGGAAAGCGTTCATCACC
205 bp
TEM TAATCAGTGAGGCACCTATCTC
GAGTATTCAACATTTCCGTGTC
800 bp
GES ATGCGCTTCATTCACGCAC
CTATTTGTCCGTGCTCAGG
846 bp
SHV GGTTATGCGTTATATTCGCC
TTAGCGTTGCCAGTGCTC
867 bp

Table 1: The sequences of primers used in PCR amplification of beta-lactamase genes.

Results and Discussion

Water borne infections still ravage the global community and are responsible for millions of deaths per year. Water that looks clear and pure may be sufficiently contaminated with pathogenic microorganisms to be a health hazard.

ESBL-producing E. coli

Ninety-nine E. coli isolates were detected and isolated from the water samples using the TSA/TBA method. Only 34 isolates were confirmed as E. coli by MicroScan. ESBL-producing strains (6⁄34) were found in all the samples analyzed by MicroScan system (Table 2). Five ESBL producing E. coli were detected from the washing water samples at five locations (Al-Khalediyah, Al-Rabwah, Al-Rawdhah, Al-Nayefiyah and Al-Nakheel) at summer season only, no winter was found. On the other hand, ESBL-producing E. coli was detected and isolated from drinking water in one location (Al-Baladiyah) out of 12.

Location Season Washing water isolates Drinking water isolates Total/ confirmed (%)
Total + Total +
Abu-Musa al-Asha'ari Winter
Summer
1
4
0
0
0
0
0
0
1/0 (0.0)
4/0 (0.0)
Al-Aziziah Winter
Summer
0
2
0
1
0
0
0
0
0/0 (0.0)
2/1 (50.0)
Al-Khalediyah Winter
Summer
1
2
0
0
0
0
0
0
1/0 (0.0)
2/0 (0.0)
Al-Rabwah Winter
Summer
0
1
0
1
0
1
0
0
0/0 (0.0)
2/1 (50.0)
Al-Muhammadiyah Winter
Summer
0
3
0
0
0
0
0
0
0/0 (0.0)
3/0 (0.0)
Al-Baladiyah Winter
Summer
1
3
0
0
0
2
0
1
1/0 (0.0)
5/1 (20.0)
Al-Rawdhah Winter
Summer
0
4
0
1
0
0
0
0
0/0 (0.0)
4/1 (25.0)
Al-Nayefiyah Winter
Summer
0
1
0
1
0
0
0
0
0/0 (0.0)
1/1 (100.0)
Al-Sulaimaniyah Winter
Summer
0
0
0
0
0
0
0
0
0/0 (0.0
0/0 (0.0)
Al-Faisaliyah Winter
Summer
0
1
0
0
0
0
0
0
0/0 (0.0)
1/0 (0.0)
Al-Masyef Winter
Summer
0
4
0
0
0
0
0
0
0/0 (0.0)
4/0 (0.0)
Al-Nakheel Winter
Summer
0
2
0
1
0
1
0
0
0/0 (0.0)
3/1 (33.3)
Total   30 5 4 1 34/6 (17.6)

Table 2: Total number and ESBL-E. coli isolates, which confirmed (+) by MicroScan system from 13 locations.

The prevalence of ESBL-producing E. coli varied between waters that differed with regard to region, type of water, and time of the year at sampling. Perhaps, prevalence may vary with the number of faecal dirtiness sources in the neighborhood of sampling sites and factors affecting when and how often releasing takes place (climate or season). Our results agreed with Blaak et al. [21]; Adnan et al. [22].

All ESBL-producing isolates also showed resistance to other antimicrobials: 100% to ampicillin, cefazolin, cefepime, cfuroxime, mezlocillin, piperacillin, trimethoprime, trimethoprime⁄sulfamethoxazole; 83.4% to ciprofloxacin, gentamicin, levofloxacin, norfioxacin, tetracycline, tobramycin; 50% to cefoxitin; 33.3% to ertapenem and 16.6% to fosfomycin, imipenem, meropenem, nitrofurantain, tigecycline (Table 3). The study by Babypadmini and Appalaraju [23] reported 74% resistance to trimethoprim/ sulfamethoxazole in ESBL-producing E. coli pathogens by disk diffusion method, which is lower than our results. This difference may be due to use of different methods of evaluation for determining the susceptibility. We determined the antimicrobial resistance by the MicroScan method which is more sensitive than disk diffusion method.

Antibiotics Washing water-E. coliisolates Drinking water-E. coliisolate
1 2 3 4 5 MIC Interps
MIC Interps MIC Interps MIC Interps MIC Interps MIC Interps
Amikacin ≤16 S >32 R ≤16 S ≤16 S ≤16 S >32 R
Amox/K Clav >16/8 R >16/8 R ≤8/4 S 16/8 I 16/8 I >16/8 R
Ampicillin >16 R >16 R >16 R >16 R >16 R >16 R
Cefazolin >16 R >16 R >16 R >16 R >16 R >16 R
Cefepime >16 R >16 R >16 R >16 R >16 R >16 R
Cefotaxime >32 ESBL >32 ESBL >32 ESBL >32 ESBL >32 ESBL >32 ESBL
Cefotaxime/K Clav. ≤0.5   ≤0.5   ≤0.5   ≤0.5   ≤0.5   ≤0.5  
Cefoxitin ≤8 S >8 R ≤8 S ≤8 S >8 R >8 R
Ceftazidime >16 ESBL >16 ESBL >16 ESBL >16 ESBL >16 ESBL >16 ESBL
Ceftazidime/k clav. 2   2       ≤0.25   ≤0.25   2  
Cefuroxime >16 R >16 R >16 R >16 R >16 R >16 R
Ciprofloxacin >2 R >2 R ≤1 S >2 R >2 R >2 R
Colistin ≤2 S ≤2 S ≤2 S ≤2 S ≤2 S >4 R
Ertapenem ≤2 S >4 R ≤2 S ≤2 S ≤2 S >4 R
Fosfomycin ≤32 S ≤32 S ≤32 S ≤32 S ≤32 S >32 R
Gentamicin >8 R >8 R ≤4 S >8 R >8 R >8 R
Imipenem ≤4 S ≤4 S ≤4 S ≤4 S ≤4 S >8 R
Levofloxacin >4 R >4 R ≤2 S >4 R >4 R >4 R
Meropenem ≤1 S ≤1 S ≤1 S ≤1 S ≤1 S >8 R
Mezlocillin >64 R >64 R >64 R >64 R >64 R >64 R
Moxifloxacin >1 R >1 R 1 I >1 R >1 R >1 R
Nitrofurantoin ≤32 S ≤32 S ≤32 S ≤32 S ≤32 S >64 R
Norfioxacin >8 R >8 R >4 S >8 R >8 R >8 R
Pip/tazo 64 I ≤16 S ≤16 S ≤16 S ≤16 S ≤16 S
Piperacillin >64 R >64 R >64 R >64 R >64 R >64 R
Tetracycline >8 R >8 R ≤ S >8 R >8 R >8 R
Tigecycline ≤1 S ≤1 S ≤1 S ≤1 S ≤1 S >2 R
Tobramycin >8 R >8 R ≤4 S >8 R >8 R >8 R
Trimeth/sulfa >2/38 R >2/38 R >2/38 R >2/38 R >2/38 R >2/38 R
Trimethoprim >8 R >8 R >8 R >8 R >8 R >8 R
S = Susceptible, I = Intermediate, R = Resistant, MIC = Minimum Inhibitory Concentration (mcg/m), Interps = Interpretation,
ESBL = Extended spectrum beta-lactamase. Suspected ESBL (confirmatory test needed to differentiate ESBL from other beta-lactamase)

Table 3: Antibiotic susceptibility pattern among ESBL-E. coli resistant isolates.

Validation of ESBL-producing isolates

ESBL confirmation test was carried out by disk diffusion method. For validity testing of 6 E. coli ESBL- producing isolates, no errors were showed between the two test methods, MicroScan and disk diffusion test.

ESBL genes

VEB and CTX-M genes were detected in 5 and 1 ESBL-producing E. coli isolates from washing and drinking water samples, respectively. The results of ESBL genotyping showed that VEB gene was the most prevalent (83.3%) followed by CTX gene (16.6%), TEM (0.0%), GES (0.0%) and SHV (0.0%). ESBL-producing E. coli isolate from drinking water was carried CTX gene (Figures 2 and 3). In washing water, only VEB gene was predominant. VEB was the most frequent resistant gene in ESBL-producing E. coli isolates in this study. The study by Rezai et al. [24] reported that TEM resistant gene was most prevalent. TEM, GES and SHV resistant genes were not found in ESBL-producing E. coli isolates which is in line with the low frequency of this gene in ESBLproducing E. coli strains [25].

pollution-effects-Agarose-gel

Figure 2: Agarose gel showing the 585 and 205bp PCR fragments band for VEB and CTX genes from ESBL-producing E. coli isolates, respectivily. Lanes: M: molecular weight marker; 1, 2, 3, 5 and 6: VEM positive washing water isolates; 4: CTX positive drinking water isolate and 7: negative control.

pollution-effects-resistance-genes

Figure 3: Distribution of resistance genes in ESBL-producing E. coli isolates.

Conclusion

Fecal contamination of tank water in Hafr Al Batin city by sewage may be occurs through discharge of untreated sewage through sewage leaking or during heavy rainfall. Water distribution and storage systems in Hafr Al-Batin city could serve as an incubator for growth of certain ARB populations and as an important reservoir for the spread of antibiotic resistance to opportunistic pathogens. Out of six ESBL-producing E. coli isolates, five were obtained from washing water tanks adjacent to sewage tanks as shown in proposed pathway of contamination transport (Figure 4). Leaks happen when a pipe isn’t sealed in a specific spot. Most old septic tanks didn’t have any sealants applied to the mating joints and troubleshooting difficult. Also, heavy vehicles can crush septic system drain lines causing leakage and toxic smells and odors. The septic cover can cause leaks because they may not be well-secured. From here, we recommend that the system of quantitative and qualitative microbial risk estimate must be applied on houses water tanks at Hafr Al-batin city. This process was successfully implemented for estimate exposure and infection hazard of bacterial and other pathogens from consumption of drinking water and washing water. Water-borne transmission has been demonstrated to be a relevant route of transmission for faecal bacterial species, including Salmonella and E. coli [26,27]. To evaluate risks of human exposure, the system of quantitative microbial risk assessment could be used [28]. This process was successfully implemented for estimate exposure and infection hazard of bacterial and other pathogens from consumption of drinking water and recreational water [29,30].

pollution-effects-adjacent-water

Figure 4: Diagram showing pathway of contaminants emission from sewage tank to adjacent water tank and groundwater.

Our results suggested the possible emissions of the ESBL-producing E. coli from sewage tanks to the environment. Water distribution systems in Hafr Al-Batin city could serve as an incubator for growth of certain ARB populations and as an important reservoir for the spread of antibiotic resistance to opportunistic pathogens.

Acknowledgement

The authors extend their appreciation to the Deanship of Scientific Research at University of Dammam for funding this work through research project no. 2014027.

References

  1. Hamelin K, Bruant G, El-Shaarawi A, Hill S, Edge TA, et al. (2007) Occurrence of virulence and antimicrobial resistance genes in Escherichia coli isolates from different aquatic ecosystems within the St. Clair River and Detroit River areas. Appl Environ Microbiol73: 477-484.
  2. Baquero F, Martínez JL, Cantón R (2008) Antibiotics and antibiotic resistance in water environments. CurrOpinBiotechnol19:260-265.
  3. Marti E, Jofre J, Balcazar JL (2013) Prevalence of Antibiotic Resistance Genes and Bacterial Community Composition in a River Influenced by a Wastewater Treatment Plant. PLoS ONE 8: e78906.
  4. Ramírez-Castillo FY, Avelar González FJ, Garneau P, MárquezDíaz F, Guerrero-Barrera AL,et al. (2013) Presence of multi-drug resistant pathogenic Escherichia coli in the San Pedro River located in the State of Aguascalientes, Mexico. Front Microbiol 4:147.
  5. Coleman BL, Salvadori MI, McGeer AJ, Sibley KA, Neumann NF, et al. (2012) The role of drinking water in the transmission of antimicrobial-resistant E. coli. Epidemiol Infect140: 633-642.
  6. Finley RL, Collignon P, Joakim-Larsson DG, McEwen SA, Li X-Z, et al. The sourge of antibiotic resistance: the important role of the environment. Clin Infect Dis 57:704-710.
  7. Tenover CF (2006) Mechanism of Antimicrobial resistance in Bacteria. Am J Infect Control 34: S3-S10.
  8. Paterson DL, Bonomo RA (2005) Extended-spectrum beta-lactamases: a clinical update. ClinMicrobiol Rev 18: 657-686.
  9. Karah N (2010) Plasmid-mediated quinolone resistance determinants qnr and aac(6’)-Ib-cr in Escherichia coli and Klebsiellaspp. from Norway and Sweden. DiagnMicrobiol Infect Dis66: 425-431.
  10. Katsanis GP, Spargo J, Ferraro MJ, Sutton L, Jacoby GA (1994) Detection of Klebsiellapneumoniaeand Escherichia colistrains producing extended spectrum beta lactamases. J Clin Microbial 32: 691-696.
  11. Jacoby GA, Sutton L (1991) Properties of plasmids responsible for production of extended-spectrum b-lactamases. Antimicrob Agents Chemother 35: 164-169.
  12. Kong K F, Schneper L, Mathee K (2010) Beta-lactam antibiotics: From antibiotic to resistance and bacteriology. APMIs 118: 1-36.
  13. Fisher JF,Meroueh SO, Mobashery S (2005) Bacterial resistance to β-lactam antibiotics: compelling opportunism, compelling opportunity. Chem Rev 105:395-424.
  14. Sassiver ML, Lewis A (1977)In: Perlman D (ed.) Structure-Activity Relationships among the Semisynthetic Antibiotics; Academic Press: New York, NY, USA 87-160.
  15. APHA (1989) Standard Methods for the examination of water and waste water, American Public Health Association, 17th Ed., Washington, DC.
  16. Singh M,Taneja N, Bhatti D, Sharma M (2002) Comparison of ReadyCult® Coliform 50 with conventional methods for detection of total coliforms and faecal Escherichia coli in drinking water samples. Eco Env Cons 8: 15-20.
  17. Snyder JW, Munier GK, Johnson CL (2008) Direct Comparison of the BD Phoenix System with the MicroScanWalkAway System for Identification and Antimicrobial Susceptibility Testing of Enterobacteriaceae and Nonfermentative Gram-Negative Organisms. J ClinMicrobiol 46:2327-2333.
  18. Clinical and Laboratory Standards Institute (2010) Performance standards for antimicrobial susceptibility testing; twentieth informational supplement M100-S20. CLSI, Wayne, PA, USA.
  19. Ahmed OB, Asghar AH, Elhassan MM (2014) Comparison of three DNA extraction methods for polymerase chain reaction (PCR) analysis of bacterial genomic DNA. Afr J Microbiol Res 8:598-602.
  20. Edelstein M, Pimkin M, Palagin I, Edelstein I, Stratchounski L (2003) Prevalence and Molecular Epidemiology of CTX-M Extended-Spectrum -Lactamase-Producing Escherichia coli and Klebsiellapneumoniae in Russian Hospitals. Antimicrobial Agents and Chemotherapy 47: 3724-3732.
  21. Blaak H, Lynch G, Italiaander R, Hamidjaja A, Schets M, et al. (2015) Multidrug-resistant and extended spectrum Beta-lactamase-producing Escherichia coli in Dutch surface water and wastewater. PLoS ONE 10: e0127752.
  22. Adnan N, Sultana M, Islam OK, Nandi SP, Hossain MA (2013) Characterization of ciprofloxacin resistant extended spectrum β-Lactamase (ESBL) producing Escherichia spp. from clinical waste water in Bangladesh.Advances in Bioscience and Biotechnology 4: 15-23.
  23. Babypadmini S, Appalaraju B (2004) Extended spectrum-lactamases in urinary isolates of Escherichia coli and Klebsiellapneumoniae-prevalence and susceptibility pattern in a tertiary care hospital. Indian J MedMicrobiol 22:172-174.
  24. Rezai MS, Salehifar E, Rafiei A, Langaee T, Rafati M, et al. (2015) Characterization of Multidrug Resistant Extended-Spectrum Beta-Lactamase-Producing Escherichia coli among Uropathogens of Pediatrics in North of Iran. BioMed Research International 1-7.
  25. Hawkey PM (2008) Prevalence and clonality of extended-spectrum β-lactamases in Asia. ClinMicrobiol Infect 14: 159-165.
  26. Søraas A, Sundsfjord A, Jørgensen SB, Liestøl K, Jenum PA (2014) Zhou D (ed.)High Rate of Per Oral Mecillinam Treatment Failure in Community-Acquired Urinary Tract Infections Caused by ESBL-Producing Escherichia coli. PLoS ONE. Public Library of Science (PLoS) 9:e85889.
  27. Rangel JM, Sparling PH, Crowe C, Griffin PM, Swerdlow DL (2005) Epidemiology of Escherichia coli O157:H7 Outbreaks, United States, 1982–2002. Emerging Infectious Diseases 11:603-609.
  28. Haas CN, Rose JB, Gerba C, Regli S (1993) Risk Assessment of Virus in Drinking Water. Risk Analysis 13:545-552.
  29. Schets FM, Schijven JF, de RodaHusman AM (2011) Exposure assessment for swimmers in bathing waters and swimming pools. Water Research 45:2392- 2400.
  30. Schijven JF, Teunis PFM, Rutjes SA, Bouwknegt M, de RodaHusman AM (2011) QMRAspot: A tool for Quantitative Microbial Risk Assessment from surface water to potable water. Water Res 45: 5564-5576.
Citation: Al Yousef SA, Farrag ES, Ali AM, Mahmoud SY (2016) Detection of Extended Spectrum Beta-Lactamase Producing Escherichia Coli on Water at Hafr Al Batin, Saudi Arabia. J Pollut Eff Cont 4:155.

Copyright: © 2016 Al Yousef SA, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Top