Internal Medicine

Internal Medicine
Open Access

ISSN: 2165-8048

Short Communication - (2021)Volume 11, Issue 1

The Sea Star Ig kappa Gene and New Concept

Michel Leclerc*
 
*Correspondence: Michel Leclerc, Department of Immunology of Invertebrates, 556 rue Isabelle Romée, 45640 Sandillon, France, Email:

Author info »

Abstract

Next to the sea star T and B lymphocytes, the preservation of the Ig kappa gene for so extended a period of evolution in organisms as distinctively different as sea star, fish, mammal, indicates that it plays an essential role in the survival of organisms role in the regulation of immune response, in Asterids. The presence of Fc receptor gene, Fab gene in Asterias rubens, MHC genes corroborate these data.

Keywords

Invertebrates; Asterids; Ig kappa genes

Introduction

The purpose of this work is to draw attention to the mass of Ig kappa genes that has accumulated on the sea star Immune system since 2011. From this year, genomes of immunized and non-immunized sea stars to (Horse-Radish Peroxidase) HRP have been studied [1]. Although IgKappa gene has been isolated [2] and found in mouse, this gene has also been detected in fish (Zebra fish and Larimiththys crocea) and mammals. In this paper we will mainly review information on a fish: Larimiththys crocea and a mammal: Tupaia chinensis, to attempt to evoke Ig kappa gene evolutionary considerations.

About the Study

Immunized and non-immunized Asterias rubens sea stars to HRP were used [1]. The axial organs were removed; RNA was extracted using Trizol (Invitrogen) according to manufacturer instructions from immunized sea stars (Horse-Radish Peroxidase) HRP and (Controls) C.

cDNA was normalized using double strand specific nuclease essentially as described by Zhulidov et al. [3]. cDNA was fragmented using DNA Fragmentase (New England Biolabs), according to the manufacturer's instructions. After ligation of adapters for Illumina's GSII sequencing system, the cDNA was sequenced on the Illumina GSII platform sequencing 100 bp from one side of the approximately 200 bp fragments. Sequences were assembled using Velvet Zerbino et al. [4]. Assembled nodes were used for further assembly including Beta vulgaris EST-Data from NCBI in MIRA [5,6].

Results

First result concern non-immunized animals that is controls and contig to Larimichthys crocea (fish)

One Contig (Contig3054|m.205) could be annotated via BLASTX to Larimichthys crocea "IgKappa chain C region" from the TREMBL database, with an e-value of 3.415e-09. On an aligned region of 102 amino acids, 46 positive and 29 identical amino acids were found.

Second one is obtained from immunized sea stars to HRP

Another Contig (Contig12275|m.10416) could be annotated via BLASTX to Larimichthys crocea "IgKappa chain C region" from the TREMBL database, with an e-value of 2.538e-09. On an aligned region of 90 amino acids, 42 positive and 24 identical amino acids were found.

At last, we discover transcriptomes of Contigs via BLASTX to the mammal: Tupaia chinensis.

• Controls

5'CCGCTGAGTTTTTGAAACATATTGCCAAGTTAAAATAT CTCATACCCTAATAATACACCATGTAATGTATTGCTTTA ACATTGTAAAGATCAATGTGTGTACTACTGTAGTTAATA TATCAGATCTCTCTGAAGTTAACACGTGTATCATACTTC ATGGAGGCATGCACCTCAGCCTTG GTTATCCCTTGGGAAAAGTTCTGTAAGAGTAGAATTGT GTACCAGTGGGACTAAACATAA TTGTGTGCATCTGTTTGGATAATATAAAAATAATATTTT ACAATGTGAAAGTATTTGTC AGTGCATGGTGTTAGGAAAATTAAAAAGACTACATTTG TTTTTCTGTTTTGTTACCTTTG CAATAAGTGTTATGACACTGTTGGAAACAATAAAATGTTCAAATTTTGTTATA3'

• Second in Immunized Sea Stars to HRP

One Contig (Contig12017|m.10218) could be annotated via BLASTX to Tupaia chinensis "Ig kappa chain V-III region HAH" from the TREMBL database, with an e-value of 3.11e-09. On an aligned region of 68 amino acids, 43 positive and 25 identical amino acids were found.

5'TGATGAATCTCTTAAAATTATATTTAAAAATTACAAATT AAAAATTATTTGATATTTTGTTCTGGCTCAAACCTTATT GTATTTTGTGTTGTATCAAGACTATGTGCCTGGACTTG GTTTGGGATCTTGCACCCCTAGGGTGGTTCTGTGGGG AACCGTGACAAGTGTTTCTGGAGGAACTTTTGTGAGAA TTGTAGAAGAACACAAGTGAACCTCATGAACAAAGCAA ACACCCACTTTGTCAGAGATAGATTATCCTGTTCACAA ATATCACAGTTATGCAGGTGTTTTTTGTTTTTT TTCAATCTTTGTCTTTTTCAGACATTTATGGCAATGCAG TCCAAGTATGCACAACCAATG TTTGTTTGTGGTAAATCTTTGTATGAAAACTATGTGTTT ATTCACACTGTGATATCTACT TAGTAAATTCATTCAATTTTCAGGGTTGATGCTTTGTAA ACTTTGCTTTTTGTATAAAAT AAGGAAACATAAATGGAATGTGAGGTAAAACAAAGTCA ACAATGTACATAAATGTGGCCAAGTCACACTAATGGGT TAAAAGATAACTTTGTAAATGAGGCGTGAGACAAATGT AACTTTTTTGTCGCAGTCTTTTCCTGTACATTCAAAAG CTGTTCATGATTTTTCATTGCAAAAATA AATAAATTGACCTTAAGAAGTTACAAGGTCATATATTAC TACAAAACCACGTTCCCCTCA TATGTTACTCTTTTGTGCACATCAGTGTAGAACCACCC ACATATGTATATTGCGCCACTG ACCTATGACATTTTGATGAATGCAATCGATGTGTAACA CTTGTGGAATATTGAAGTGTGT GTAGTACAATGGCACATTGTCCGTGTTTTGTATAAAAA TAGGAAATAAAATGGTACACCA CT3'

There is evidence for the presence of Ig kappa genes through the animal kingdom. These results are summarized in Table 1 and Table 2:

Control Genes
Contig3054|m.205 tr|A0A0F8CMX3|A0A0F8CMX3_LARCR Ig kappa chain C region OS=Larimichthys crocea GN=EH28_01288 PE=4 SV=1
Contig3376|m.6635 tr|L9JQR9|L9JQR9_TUPCH Ig kappa chain V-III region HAH OS=Tupaia chinensis GN=TREES_T100021693 PE=4 SV=1
Contig15579|m.12525 tr|L8HL23|L8HL23_9CETA Ig kappa chain V-III region SIE (Fragment) OS=Bos mutus GN=M91_06423 PE=4 SV=1
TR38397|c0_g1_i1|m.2857 tr|A0A0F8C094|A0A0F8C094_LARCR Ig kappa chain V-I region Wes OS=Larimichthys crocea GN=EH28_01990 PE=4 SV=1
TR48242|c0_g3_i1|m.3430 tr|A0A091ENA6|A0A091ENA6_FUKDA Ig kappa chain V-VI region NQ2-6.1 (Fragment) OS=Fukomys damarensis GN=H920_01478 PE=4 SV=1

Table 1: The Ig kappa genes in controls.

And now, what about immunized sea stars to HRP?

Control Genes
Contig12017|m.10218  tr|L9JQR9|L9JQR9_TUPCH Ig kappa chain V-III region HAH OS=Tupaia chinensis GN=TREES_T100021693 PE=4 SV=1(similar protein)
Contig12275|m.10416 tr|A0A0F8CMX3|A0A0F8CMX3_LARCR Ig kappa chain C region OS=Larimichthys crocea GN=EH28_01288 PE=4 SV=1
Contig8150|m.7973 tr|A0A0F8CMX3|A0A0F8CMX3_LARCR Ig kappa chain C region OS=Larimichthys crocea GN=EH28_01288 PE=4 SV=1
Contig18903|m.13528 tr|L8HL23|L8HL23_9CETA Ig kappa chain V-III region SIE (Fragment) OS=Bos mutus GN=M91_06423 PE=4 SV=1
Contig12300|m.10433 tr|A0A091DDJ6|A0A091DDJ6_FUKDA Ig kappa chain V-V region T1 OS=Fukomys damarensis GN=H920_10033 PE=4 SV=1
Contig11501|m.9857 sp|P01841|KAC5_RABIT Ig kappa-b5 chain C region OS=Oryctolagus cuniculus

Table 2: The Ig kappa genes in HRP (from immunized sea stars to HRP).

Conclusion

The sea star Ig kappa gene is clearly the oldest Ig kappa gene of the immune system of animals. It shows already two Ig sites! The forms of Ig kappa genes are all found in vertebrates, they share many details with the sea star, including the presence of Ig sites. The preservation of the Ig kappa gene in immunized and nonimmunized sea stars is an excellent opportunity for further experiments. It is important to notice that the Ig kappa chain VIII region HAH of Tupaia chinensis is situated (in the assumptions behind the theory of evolution) between the Ig kappa chain precursor V-II region (RPMI/133) and Ig kappa chain precursor V-IV region/121. The preservation of the IgKappa gene for so extended a period of evolution in organisms as distinctively different as sea star, fish, rodent, mammal, indicates that it plays an essential role in the survival of the organisms, role in the regulation of the immune response. Additionally, the existence of members of the IgKappa gene family with conserved functional characters, indicate that the sea star Ig kappa gene has evolved prior to the evolutionary divergence between Invertebrate and Vertebrates: It must be claimed. On the other hand, the discovery of a Fc receptor gene, of a Fab gene, MHC genes, in Asterias rubens genome, corroborate the presence of the Invertebrate Primitive Antibody (IPA) in Asterids.

References

  1. Leclerc M, Kresdorn N, Horres R. Asterias rubens: Evidence of NF-Kappa B Genes. Immunol Lett. 2011;138(19):7-198.
  2. Vincent N, Osteras M, Otten P, Leclerc M. A new gene in Asterias rubens: A sea star Ig kappa gene. Meta Gene. 2014;2:320-322.
  3. Zhulidov PA, Bogdanova EA, Shcheglov AS, Vagner LL, Khaspekov GL, Kozhemyako VB, et al. Simple cDNA normalization using kamchatka crab duplex‐specific nuclease. Nucleic Acid Res. 2004; 32(3): e37.
  4. Zerbino DR, Birney E. Velvet: Algorithms for de novo short read assembly using de Bruijn graphs. Genome Res. 2008;18(5):821-829.
  5. Leclerc M. Like an invertebrate primitive antibody. Amer J Immunol. 2013;9:94-95.
  6. Leclerc M, Jolly A, Grangel P. Evidence of Complement Genes in the Crinoïd: Antedon bifida. Comparisons with other Echinodermata. Int J Biotech Bioeng. 2018; 2(1): 37-38.

Author Info

Michel Leclerc*
 
Department of Immunology of Invertebrates, 556 rue Isabelle Romée, 45640 Sandillon, France
 

Citation: Leclerc M (2021) The Sea Star Ig kappa Gene and New Concept. Intern Med. 11:327.

Received: 31-Dec-2020 Accepted: 14-Jan-2021 Published: 21-Jan-2021 , DOI: 10.35248/2165-8048.21.11.327

Copyright: © 2021 Leclerc M. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Top