Andrology-Open Access
Open Access

Inequality of X- and Y-Sperm in Human Ejaculates

Laurence Fishel^{* *}Correspondence: Laurence Fishel, Department of Andrology, University of Cambridge, Chicago, USA, Email:

Author info »

Description

The study objective was to determine the percentages of X and Ysperm simultaneously in an ejaculate and validate our earlier study using only SRY. A real-time Polymerase Chain Reaction (qPCR) assay was developed and used to calculate the percentages of X and Y-sperm in individual ejaculates from fourteen randomly selected men. There was a significant difference (p<0.05) in the mean ± SD between the proportion of X and Y-sperm (55.12 ± 11.72 vs. 44.88 ± 11.72). Six (43%) of the fourteen ejaculates had more than 10% difference between the percentage of X and Y-sperm, confirming the variation in the percentages of X and Y sperm in ejaculates [1]. The percentages of X and Y-sperm in any sample should be equal due to meiotic division during spermatogenesis, however, critical review of publications revealed a wide variation in the ratio of X and Ysperm in humans and various other species [2]. These studies did not definitively determine the underlying reasons for this variation but included motility and related variables and genetic instability. Additionally, the uterus and oviduct may be involved as well, since they may select only functional sperm for fertilization. When spermatozoa were exposed to different pH values (5.5-9.5), increased temperatures (37°C-45°C) and Reactive Oxygen Species (ROS) levels (50-1,000 µ M), and the live and dead cells were then separated using a modified swim-up technique. From these conditions, incubation in acidic media, increased temperatures and elevated H₂O₂ resulted in X chromosome-bearing spermatozoa enrichment. It is therefore not surprising our earlier blinded, randomized study of the variation of Y-bearing sperm within human ejaculates with Sexdetermining Region Y (SRY gene) using real-time quantitative Polymerase Chain Reaction (qPCR) revealed a wide variation in percentage of Y sperm among 50 randomly selected men. To clarify the results in relation to the X sperm, the homologous amelogenin gene was used to reconfirm the earlier findings by measuring the percentages of both X and Y sperm simultaneously in any sample [3].

Ejaculates from 14 men were frozen following routine semen analysis. Buccal swabs were also collected from each of these men and stored dry until use. The Institutional Review Board exempted this study under 45 CFR 46.101(b) (4). Informed consent was obtained from each participant. Frozen sperm samples were thawed, and DNA extracted from each sample and from the corresponding buccal swabs using the qiagen qia amp DNA Mini Kit. Additionally, the 14 semen samples were pooled, and a DNA extract made from the pool [4].

To determine X and Y sperm percentages simultaneously in each sample, a quantitative PCR assay was developed using the SRY sex-determining region Y (Y-chromosome) and the amelogenin gene (X-chromosome), using the Peptidyl-Prolyl cis-trans Isomerase H gene (PPIH) as a reference gene for normalization of data, since it is a housekeeping gene and therefore present in all samples. Primers and probes were made by LGC Bio Search Technologies (Novato, CA). Sequences were:SRY(reverse):CATCGCTGTTGAATACGCTTAAC;SRY(pr obe):TGACAATGCAATCATATGCTTCTGC (label:CalFluor610).

AMELXX(forward):CCTGATTCTAAGATAGTCACACTCTAT G;AMELX(reverse):TTCTGCGGAGTCTCTCCTATAC;AMEL XX(probe):TGTCTCTTGCTTGCCTCTGCTGAA;(label:FAM); PPIH(forward):TGGTGACAGTGATAGAAGGTAATG;PPIH(r everse):GACTCTCCTAAAGATGGTTGAC;PPIH(probe):CCA AGGGTCTGTCCCTAGTTTATTTGCC;(label: Quasar 670).

qPCR was performed on a BIO-RAD IQ5 Multicolor Real-Time PCR Detection System, with Platinum™ Multiplex PCR Master Mix (Thermo Fisher); each primer concentration was 500 nM and probe 125 nM in a multiplex using thermal cycling parameters described, with 10 ng sperm genomic DNA as the input template. The X and Y sperm mean percentage for each sample was calculated using theΔΔCt method [5-7].

There was significant difference (p<0.05) in the mean ± SD between the proportion of X and Y sperm (55.12 ± 11.72 vs. 44.88 ± 11.72). Variation in the percentages of X and Y sperm was seen among the ejaculates of the 14 individuals; six (42.86%) had more than 10% difference between the percentage of X or Y sperm Table 1. Our pooled ejaculate when compared to buccal cells had an almost identical ratio (52:48).

These results confirm our earlier findings of variation in the ratio of X to Y-sperm in ejaculates of 50 individuals. As revealed in Table 1, the variation was significant. More critical: the possibility that any ejaculate may be more likely to deviate from an expected 1:1 ratio than conform to it. The significant difference in the mean between the two populations is probably due to the small numbers of ejaculates evaluated (Table 1).

Table 1: Percentages of X and Y-Sperm in ejaculates from fourteen randomly selected men.

Six of the fourteen samples had more than 10% difference between the X or Y-sperm from the respective ejaculates.

Conclusion

The disparity in percent X-sperm and Y-sperm in individual ejaculates is supported by studies such as the following that showed ligand activation of Toll-Like Receptors 7/8 (TLR7/8) selectively encoded by the X-chromosome produced over 90% male embryos in mice following in vitro fertilization increased proportion of X sperm in mice and humans with increased Y aneuploidy in spermatozoa, that selectively eliminated the Y sperm.

Therefore, genetic factors may differentially affect the sperm sex ratio by making one type more sensitive to loss than the other, confirming the possibility of disproportion between the percentage of X and Y-sperm in an ejaculate as found in our studies.

References

1. Bibbins Jr PE, Lipshultz LI, Ward Jr JB, Legator MS. Fluorescent body distribution in spermatozoa in the male with exclusively female offspring. Fertil Steril. 1988;49(4):670-675.

   [CrossRef] [Google Scholar] [PubMed]

2. Chaudhary I, Jain M, Halder A. Sperm sex ratio (X:Y ratio) and its variations. Austin J Reprod Med Infertil. 2014;1(1):7.

   [Google Scholar]

3. Jeyendran RS, Graham J, Tharma S, Ivanovic M, Levrant S, Ozornek HM. Individual variation of the percentage of Y-chromosome bearing sperm content in human ejaculates. Syst Biol Reprod Med. 2021;67(5):395-398.

   [CrossRef] [Google Scholar] [PubMed]

4. Martin RH, Balkan W, Burns K, Rademaker AW, Lin CC, Rudd NL. The chromosome constitution of 1000 human spermatozoa. Hum Genet. 1983;63:305-309.

   [CrossRef] [Google Scholar] [PubMed]

5. Quinlivan WL, Sullivan H. The ratios and separation of X and Y spermatozoa in human semen. Fertil Steril. 1974;25(4):315-318.

   [CrossRef] [Google Scholar] [PubMed]

6. Umehara T, Tsujita N, Shimada M. Activation of Toll-like receptor 7/8 encoded by the X chromosome alters sperm motility and provides a novel simple technology for sexing sperm. PLoS Biol. 2019;17(8):e3000398.

   [CrossRef] [Google Scholar] [PubMed]

7. Hounkpe BW, Chenou F, de Lima F, de Paula EV. HRT Atlas v1. 0 database: Redefining human and mouse housekeeping genes and candidate reference transcripts by mining massive RNA-seq datasets. Nuc Acid Res. 2021;49(1):947-955.

   [CrossRef] [Google Scholar] [PubMed]