Andrology-Open Access
Open Access

A new heterozygous deletion mutation of the SYCP2 gene caused male infertility due to non-obstructive azoospermia

Lin Tan¹, Qi Yang^2,3, Jianan Liu³, Weijun Zhong³, Zhongzhi Gan³, Qian Liu⁴, Xuedong Wu^1* and Fu Xiong^{3 *}Correspondence: Xuedong Wu, Department of Pediatrics, Southern Medical University, Guangzhou, China, Email:

Author info »

Introduction

Approximately 10%-20% of heterosexual couples worldwide experience infertility [1], which is characterized by failure to conceive after engaging in regular unprotected sexual intercourse for 12 months. Approximately half of the infertility cases are believed to be caused by male factors [2]. Male infertility can be attributed to various factors, which can be categorized into four main causes: quantitative deficiencies in spermatogenesis, dysfunction or obstruction of the ductal system, disturbances in the hypothalamic-pituitary axis and qualitative deficiencies in spermatogenesis [3]. Among the male infertility community, azoospermia is considered the most clinically severe form. Azoospermia, which is defined as the total lack of sperm in the semen, is found in approximately 1% of males overall and in 10%-15% of males who are unable to conceive [4]. Azoospermia exhibits a wide range of phenotypic presentations, which can be categorized into Non-Obstructive Azoospermia (NOA) and Obstructive Azoospermia (OA) based on the underlying cause. OA is characterized by a lack of sperm in the ejaculate resulting from a blockage in sperm transportation, whereas NOA is caused by either primary or secondary testicular dysfunction [5]. NOA, an important type of azoospermia, represents >70% of all azoospermia cases [6].

Our current understanding shows that NOA appears to be strongly associated with genetic factors. Due to the significant advancements in high-throughput sequencing in recent years, Whole-Exome Sequencing (WES) has emerged as a valuable asset in identifying genetic variations linked to NOA. Recent extensive WES investigations concerning NOA have revealed that established genetic elements contribute to 23% of the etiology of this disorder [7], emphasizing the crucial involvement of genetics in NOA progression. Mutations in meiotic genes are primarily responsible for NOA occurrence. Many genes have been identified and their genetic variants may result in human NOA, including C140rf39 [8], DMC1 [9], KASH5 [10], MSH4 [11], SHOC1 [12,13], SPINK2 [14], SYCP1, SYCP2, TEX11, etc. Among them, Synaptonemal Complex Protein 2 (SYCP2), an essential molecule, plays an irreplaceable role during sperm occurrence and development.

SYCP2 is located on chromosome 20q13.33 and consists of 45 exons. In addition, it encodes an intracellular protein containing 1530 amino acids. Moreover, SYCP2 protein in the human body has tissue specificity since it is mainly expressed in testicular tissue. In previous studies, Offenberg et al., discovered for the first time that Sycp2 was transcribed specifically in meiotic prophase cells in rat testes. It can bind to DNA and assemble into axial elements. Yang et al., conducted a series of mouse experiments to prove that SYCP2 plays a crucial role in the Synaptonemal Complex’s (SC) assembly and synapsis of chromosomes during male meiosis. Sycp2-/- male mice appear sterile. By utilizing sycp2 hypomorphic and knockout mutant zebrafish lines, Takemoto et al. demonstrated that Sycp2 plays a crucial role in SC formation, as well as in the early stages of homologous pairing and meiotic recombination in vertebrates. These results indicate that SYCP2 mutation may influence male genital cell meiosis, which further causes male infertility [15].

To date, there have been only two documented instances where NOA is linked to SYCP2 mutations. However, the causes of NOA have been incompletely understood. The current research focuses on examining a Chinese Han family affected by NOA. To investigate the etiology of NOA, we examined pathogenic mutations in this family by analyzing clinical phenotypes and functional aspects.

Materials and Methods

Patient

A 24-year-old male patient who had previously undergone sperm testing at different hospitals was referred to the Department of Andrology at the Reproductive Medical Center, Women and Children’s Health Hospital of Guangxi Zhuang Autonomous Region, for additional examination due to sperm loss. This study was approved by the Institutional Review Board and Ethics Committee of Guangxi Maternal and Child Health Hospital (GXMC20230310) and performed in accordance with the Declaration of Helsinki. All participants provided written consent before participating in the study [16].

WES and Sanger sequencing

WES was conducted on the blood samples from the proband. Azoospermia-associated gene mutations within exon 24 of SYCP2 identified by WES were confirmed by Sanger sequencing. Blood samples from the proband’s parents were subjected to Sanger sequencing.

Bioinformatics analyses

Iterative Threading ASSEmbly Refinement (I-TASSER) was utilized to forecast the three-dimensional (3D) protein structures of mutant (MUT) and wild-type (WT) SYCP2 proteins. The prediction can be found at the website (https://zhang group.org// I-TASSER/). The sequences of SYCP2 from various species were acquired from the UniProt database (https://www.uniprot.org/). We aligned SYCP2 sequences among different species on the Tcoffee website (https://www.ebi.ac.uk/Tools/msa/tcoffee/) to analyze the conservation of the mutant sites [17].

Plasmids construction and cell transfection

The pEGFP-C1 vector was used to generate the WT plasmid by directly inserting the cDNA of human SYCP2. Using the WT plasmid as a template, the MUT plasmid was created and verified using Sanger sequencing. The analysis of function was conducted using HEK293T cells, derived from human embryonic kidney, that were cultured in complete medium prepared with 90% DMEM(Gibco, USA) and 10% fetal bovine serum (Gibco, USA) at a temperature of 37°C and with a CO₂ concentration of 5%. HEK293T cells were transfected with recombinant plasmids carrying either MUT or WT SYCP2 genes at a ratio of 3:1 for PEI (1 μg/μL) to the plasmid [18].

RNA expression analysis

HEK293T cells were transfected with 1.5 μg/well of the recombinant plasmids in 12-well plates. Following a 24-h transfection period, the cell lysates were utilized to extract total RNA with Trizol reagent (Invitrogen, USA). Subsequently, the RNA was reverse-transcribed into cDNA using RevertAid Master Mix (Thermo Scientific, USA). PowerUp™ SYBR™ Green Master Mix (Thermo Scientific, USA) was used for quantitative real-time PCR (qPCR) to compare SYCP2 mRNA expression levels between HEK293T cells carrying WT and MUT plasmids. The 2–ΔΔCT method was used to calculate results. QPCR primers for amplifying SYCP2 were as follows: the forward primer sequence was AGATTCACAGGCAGCGGAAA and the reverse primer sequence was TACAGGTGTCCAACATGCCC. The forward primer for GAPDH amplification was ATCAGCAATGCCTCCTGCAC and the reverse primer was TGGCATGGACTGTGGTCATG.

Western blotting analysis

Cells transfected with recombinant plasmids harboring normal or altered SYCP2 were collected and rinsed with chilled PBS (Gibco, USA). To lyse the cells and prevent protein degradation, RIPA lysis buffer (Beyotime, China) was utilized, along with adding 1% PMSF (Beyotime, China). Next, the protein lysates were separated using 7.5% SDS-polyacrylamide gel electrophoresis (EpiZyme, China) and transferred to PVDF membranes (Millipore, USA). Following a 1.5-h incubation with 5% nonfat milk at room temperature, the membranes were incubated with either SYCP2 rabbit polyclonal antibody (CN.A16098, ABclonal, China) or β- tubulin rabbit polyclonal antibody (CN.10094-1-AP, Proteintech, China) overnight at 4°C. After incubation with goat secondary antibodies (CN.CW0103S, CWBIO, China) at ambient temperature for 1 h, protein expression was detected using an enhanced chemiluminescent reagent (NCM Biotech, China) and digital chemiluminescence system (Tanon Science and Technology, China) [19].

Immunofluorescence staining

HEK293T cells were grown on confocal dishes and treated with 4% paraformaldehyde for 15 min after 48 h of transfection. After rinsing thrice with PBS, the samples were treated with 0.2% Triton X-100 (Thermo Fisher Scientific, USA) for 15 min to achieve permeabilization. Finally, the cells were washed thrice with PBS and stained with DAPI (Beyotime, China) for 10 min in the dark. A inverted laser confocal microscope (LSM 880; Carl Zeiss, Germany) was utilized to observe the fluorescence of HEK293T cells [20].

Statistical analysis

Statistical analyses were conducted using the GraphPad Prism 10.0 software. A minimum of three independent biological replicates were conducted for all experiments. The results are expressed as the mean ± standard deviation. The two independent sample t-test was employed to determine the statistical significance of the disparities between the two groups. We defined a P-value<0.05 as a statistically significant difference. Asterisks indicate significance in more detail, where *means p<0.05, **means p<0.01, ***means p<0.001 and ****means p<0.0001 [21].

Results

Clinical phenotype

The proband had a history of male infertility for more than one year. He was married in 2021 and did not take any precautions after marriage. However, to date, he has been infertile. He had a normal sexual life and could ejaculate smoothly, with a moderate volume, without erectile dysfunction or premature ejaculation. Regarding medical history, no consanguineous marriage was observed in the Proband’s family. Physical examination revealed that the proband had normal male secondary sexual characteristics and the volume of the bilateral testes was 12 mL. The texture of his bilateral epididymis was normal, without nodules, tenderness or varicoceles. The vas deferens of both sides can be palpated. Laboratory tests revealed that the serum FSH level was within the normal range (4.28 mIU/mL). The karyotype was 46, XY, del (10) (p13). Genetic testing for Y chromosome microdeletions yielded negative results. Nevertheless, semen analysis revealed a normal volume but an absolute absence of sperm (Table 1) [22].

Table 1: Semen analysis results of the proband.

Mutation detection and bioinformatics analysis

To identify the cause of azoospermia, we conducted a genealogical analysis of this lineage. The lineage map was shown in Figure 1A. We collected the proband’s peripheral blood for WES. The results indicated that the patient carried a novel heterozygous deletion variant, c.1937_1942delTAAATA, p. Ile646_Asn647del, located at exon 24 of SYCP2 on chr20 (Figure 1B). SYCP2 participates in SC formation during meiosis. This deletion mutation may be a possible pathogenic mutation in azoospermia. Sanger sequencing confirmed the deletion mutation of SYCP2 in the proband (Figure 1C). The mutation also existed in the proband’s mother, indicating that it was inherited from her. To estimate amino acid conservation in SYCP2 p.I646 and p.A647, we compared sequences from various species. The results depicted that the amino acid at position 647 was highly conserved, whereas the amino acid at position 646 was not (Figure 2A). Furthermore, a notable disparity was observed in the protein's 3D structures between WT and MUT, as depicted in Figure 2B [23].

Figure 1: Identification of a novel deletion mutation c. 1937_1942delTAAATA in SYCP2 gene. (A) The pedigree chart of the NOA family. Black arrow indicates the proband. (B) A schematic diagram of the SYCP2 mutation c. 1937_1942delTAAATA, p. Ile646_Asn647del. Punctuation means ellipsis. NTR represents N-terminal region and CCR represents C-terminal coiled-coil domain. (C) Sanger sequencing confirmed the mutation in the proband and his parents.

Figure 2: Biological analysis of the mutation. (A) The conservation analysis of the amino acid mutant sites. The Asn at 647 was highly conserved while the Ile at 646 was not. (B) The 3D structure visualization of the Wide-Type (WT) and mutant (MUT) protein. The mutant models of p. Ile646_Asn647del is significantly distinct compared with the wide-type.

Functional analysis after plasmid transfection

To clarify the impact of SYCP2 p.Ile646_Asn647del on SYCP2 expression, we transfected MUT and WT plasmids into HEK293T cells and extracted RNA and protein. In the level of SYCP2 mRNA expression, we didn’t find any difference between WT and MUT groups (Figure 3A). At the protein level, the expression of the MUT SYCP2 protein was significantly decreased compared with that of the WT protein (P=0.0101, Figure 3B and 3C). Furthermore, immunofluorescence was conducted to determine the subcellular localization of MUT and WT proteins following transfection with SYCP2 recombinant plasmids. It was observed that MUT SYCP2 was present in both the cytoplasm and nucleus, whereas WT SYCP2 was only found in the nucleus (Figure 4) [24].

Figure 3: The effect of the mutation on SYCP2 expression. (A) Relative SYCP2 mRNA expression of HEK293T cells after transfected with wide-type (WT) and mutant (MUT) plasmids (ns, no significance). (B-C) Western blotting tested the SYCP2 protein expression of wild-type and mutant SYCP2 gene in HEK293T cells (*P=0.0101). The control group is HEK293T cells transfected with blank plasmid.

Figure 4: Immunofluorescence staining revealed the subcellular location of Wide-Type (WT) and mutant (MUT) SYCP2 in HEK293T cells. Wide-type SYCP2 was exclusively located in nucleus. Mutant SYCP2 not only located in nucleus but also in cytoplasm as red arrow indicated. Confocal images of EGFP (green), DAPI nuclear staining (blue) and merged signals.

Discussion

In the current study, we discovered a new deletion mutation c. 1937_1942delTAAATA in SYCP2 from a family with NOA affected by one person. It has been verified that this genetic alteration causes a reduction in the production of the SYCP2 protein, alteration in its distribution within the cell and consequently leads to sperm disorders and inability to conceive. The results of our study emphasize the crucial function of SYCP2 in spermatogenesis and broaden the range of genetic variations associated with NOA. In addition, our findings offer fresh perspectives on NOA development [25].

The gold standard investigation for male infertility is a semen analysis conducted following the guidelines of the World Health Organization (World Health Organization, 2010). In this family, the proband was infertile for more than one year without taking precautions. Semen analysis displayed that the sperm concentration was zero, which conformed to clinical azoospermia. Using WES, we identified a heterozygous SYCP2 frameshift variant (c.1937_1942delTAAATA) in the proband. Sanger sequencing verified his mother as a SYCP2 (c. 1937_1942delTAAATA) heterozygote. The SYCP2 mutation in the proband was derived from his mother. According to the lineage map, the inheritance mode was dominant. This is consistent with the inheritance mode of an azoospermic family reported by Schilit in 2019, in which the proband and his mother were SYCP2 (c.2793_2797del) heterozygote. Because of the specificity of SYCP2 protein expression in the human body and the genital differences between males and females, SYCP2 mutations cause male infertility while females are fertile. Consequently, it is plausible that most SYCP2 mutations are inherited maternally. However, it is notable that Xu et al. reported a male infertile patient with a homozygous mutation in SYCP2 (c.2689_2690insT) presented with NOA, whose parents were SYCP2 (c.2689_2690insT) heterozygote. This finding contradicts the results of the current study. We believe that haploinsufficiency and incomplete dominance may be the reasons. As a result of different expressivity caused by SYCP2 encoding errors and deletions, disease manifestations vary from oligozoospermia to azoospermia. The differences between the present study and animal experiments can also be explained by this notion. In a previous study, male Sycp2-/- mice were infertile, whereas Sycp2+/- mice were fertile. This may be due to human haploinsufficiency and/or mouse incomplete dominance. Furthermore, the interplay between genes and the environment is intricate and this collaboration may collectively govern the manifestation of various phenotypes. Moreover, there may be certain compensatory mechanisms in mice that are incompletely understood, but they still play an equal role in shaping the ultimate phenotype [26,27].

SYCP2 encodes synaptonemal complex protein 2, which participates in meiosis in sexually reproducing organisms. Meiosis is a unique cellular fission process that decreases chromosome count by half via two consecutive rounds of meiotic division, forming haploid gametes, SYCP2 facilitates the formation of pairs of homologous chromosomes by constructing SC during meiosis. The highly conserved protein structure known as SC is crucial in connecting homologous chromosomes in various species. The SC consists of three components: the Central Component (CC), Transverse Filaments (TF) and Lateral Elements (LE). Among them, the LE mainly comprises SYCP2 and SYCP3 proteins. The interaction between these two proteins forms a central core for the chromosome axis, providing a framework for chromatin looping and assisting in the assembly of the chromosome axis [28,29].

To investigate the impact of c.1937_1942delTAAATA on the functionality of SYCP2, we constructed a MUT SYCP2 vector specifically for conducting in vitro experiments. In our functional investigations, we found that MUT SYCP2 expression was decreased compared to the WT SYCP2 protein and the two independent samples t-test demonstrated that the difference was statistically significant. The reduction in SYCP2 protein may lead to incomplete SC, further influencing homologous chromosome synapsis. Additionally, we found significant differences between the MUT and WT SYCP2 proteins by analyzing the protein 3D structures. The C-terminal coiled-coil domain of SYCP2 can recruit SYCP3 and incorporate SYCP3 into the LE. SYCP3 effectively localizes to the SC in WT mice, but in Sycp2-/- mice, it forms aggregates within the nucleus instead of localizing to the LE. Moreover, the N-terminal region (NTR) of SYCP2 mediates the combination of the centromere with the SC. SYCP2 NTR interacts with two centromere proteins, CENP J and CENP F. The significant change in the 3D structure of the MUT SYCP2 protein may cause SYCP3 to combine unsuccessfully and then fail to form a holonomic SC while also affecting the centromere combined with the SC. This study also observed that the novel SYCP2 variant (c.1937_1942delTAAATA) led to abnormal subcellular localization. This may be because the novel mutation influences the nuclear localization signal. Abnormal nuclear localization of proteins may further aggravate the poor integrity of the SC during meiosis. However, the underlying molecular mechanisms must be explored in depth [30].

Conclusion

In summary, we detected a heterozygous deletion mutation (c. 1937_1942delTAAATA, p. Ile646_Asn647del) in SYCP2 through WES in a NOA family. Functional in vitro studies revealed the influence of the new variant on SYCP2 protein localization and expression. These results suggest that the SYCP2 novel mutation leads to abnormal meiosis by affecting SC formation, ultimately resulting in male NOA. This investigation is advantageous in enhancing our understanding of the molecular foundation of meiosis abnormality and the pathological mechanism of NOA.

Data Availability Statement

The data underlying this article are available in the article and in its online supplementary material, further inquiries can be directed to the corresponding authors.

Ethical Approval

This study was approved and performed in accordance with the Institutional Review Board and Ethics Committee of Guangxi Maternal and Child Health Hospital (GXMC20230310). Patients and relatives analyzed in the project signed informed consent prior to inclusion.

Acknowledgements

We thank the patients and their family members for consenting to this research.

Authors’ Contributions

Lin Tan and Jianan Liu designed this study. Qi Yang recruited the patient and collected clinical datas. Lin Tan, Jianan Liu, Weijun Zhong, Zhongzhi Gan and Qian Liu performed functional experiments and data analysis. Lin Tan and Jianan Liu performed biological analysis. Lin Tan, Qi Yang and Jianan Liu drafted the manuscript. Fu Xiong and Xuedong Wu were responsible for the manuscript review. All authors contributed to acquisition of data and draft of the manuscript. All authors have read and approved the final manuscript.

Funding

This work was supported mainly by a grant from National Key S&T Special Projects (2021YFC100530, 2022YFC2703303), National Natural Science Foundation of China (32370649, 31970558).

Conflict of Interest

The authors declare no conflict of interest.

References

1. Eisenberg ML, Esteves SC, Lamb DJ, Hotaling JM, Giwercman A, Hwang K, et al. Male infertility. Nat Rev Dis Primers. 2023;9(1):49.

   [Crossref] [Google Scholar] [PubMed]

2. Minhas S, Bettocchi C, Boeri L, Capogrosso P, Carvalho J, Cilesiz NC, et al. European association of urology guidelines on male sexual and reproductive health: 2021 update on male infertility. Eur Urol. 2021;80(5):603-620.

   [Crossref] [Google Scholar] [PubMed]

3. Krausz C, Riera-Escamilla A. Genetics of male infertility. Nat Rev Urol. 2018;15(6):369-384.

   [Crossref] [Google Scholar] [PubMed]

4. Cocuzza M, Alvarenga C, Pagani R. The epidemiology and etiology of azoospermia. Clinics (Sao Paulo). 2013;68 Suppl 1(Suppl 1):15-26.

   [Crossref] [Google Scholar] [PubMed]

5. Carson SA, Kallen AN. Diagnosis and management of infertility: A review. JAMA. 2021;326(1):65-76.

   [Crossref] [Google Scholar] [PubMed]

6. Cioppi F, Rosta V, Krausz C. Genetics of Azoospermia. Int J Mol Sci. 2021;22(6):3264.

   [Crossref] [Google Scholar] [PubMed]

7. Kherraf ZE, Cazin C, Bouker A, Fourati Ben Mustapha S, Hennebicq S, Septier A, et al. Whole-exome sequencing improves the diagnosis and care of men with non-obstructive azoospermia. Am J Hum Genet. 2022;109(3):508-517.

   [Crossref] [Google Scholar] [PubMed]

8. Fan S, Jiao Y, Khan R, Jiang X, Javed AR, Ali A, et al. Homozygous mutations in C14orf39/SIX6OS1 cause non-obstructive azoospermia and premature ovarian insufficiency in humans. Am J Hum Genet. 2021;108(2):324-336.

   [Crossref] [Google Scholar] [PubMed]

9. He WB, Tu CF, Liu Q, Meng LL, Yuan SM, Luo AX, et al. DMC1 mutation that causes human non-obstructive azoospermia and premature ovarian insufficiency identified by whole-exome sequencing. J Med Genet. 2018;55(3):198-204.

   [Crossref] [Google Scholar] [PubMed]

10. Fakhro KA, Elbardisi H, Arafa M, Robay A, Rodriguez-Flores JL, Al-Shakaki A, et al. Point-of-care whole-exome sequencing of idiopathic male infertility. Genet Med. 2018;20(11):1365-1373.

    [Crossref] [Google Scholar] [PubMed]

11. Krausz C, Riera-Escamilla A, Moreno-Mendoza D, Holleman K, Cioppi F, Algaba F, et al. Genetic dissection of spermatogenic arrest through exome analysis: Clinical implications for the management of azoospermic men. Genet Med. 2020;22(12):1956-1966.

    [Crossref] [Google Scholar] [PubMed]

12. Yao C, Yang C, Zhao L, Li P, Tian R, Chen H, et al. Bi-allelic SHOC1 loss-of-function mutations cause meiotic arrest and non-obstructive azoospermia. J Med Genet. 2021;58(10):679-686.

    [Crossref] [Google Scholar] [PubMed]

13. Wang W, Meng L, He J, Su L, Li Y, Tan C, et al. Bi-allelic variants in SHOC1 cause non-obstructive azoospermia with meiosis arrest in humans and mice. Mol Hum Reprod. 2022;28(6):gaac015.

    [Crossref] [Google Scholar] [PubMed]

14. Kherraf ZE, Christou-Kent M, Karaouzene T, Amiri-Yekta A, Martinez G, Vargas AS, et al. SPINK2 deficiency causes infertility by inducing sperm defects in heterozygotes and azoospermia in homozygotes. EMBO Mol Med. 2017;9(8):1132-1149.

    [Crossref] [Google Scholar] [PubMed]

15. Pashaei M, Rahimi Bidgoli MM, Zare-Abdollahi D, Najmabadi H, Haji-Seyed-Javadi R, Fatehi F, et al. The second mutation of SYCE1 gene associated with autosomal recessive nonobstructive azoospermia. J Assist Reprod Genet. 2020;37(2):451-458.

    [Crossref] [Google Scholar] [PubMed]

16. Maor-Sagie E, Cinnamon Y, Yaacov B, Shaag A, Goldsmidt H, Zenvirt S, et al. Deleterious mutation in SYCE1 is associated with non-obstructive azoospermia. J Assist Reprod Genet. 2015; 32(6):887-891.

    [Crossref] [Google Scholar] [PubMed]

17. Feng J, Fu S, Cao X, Wu H, Lu J, Zeng M, et al. Synaptonemal complex protein 2 (SYCP2) mediates the association of the centromere with the synaptonemal complex. Protein Cell. 2017;8(7):538-543.

    [Crossref] [Google Scholar] [PubMed]

18. Yatsenko AN, Georgiadis AP, Röpke A, Berman AJ, Jaffe T, Olszewska M, et al. X-linked TEX11 mutations, meiotic arrest, and azoospermia in infertile men. N Engl J Med. 2015;372(22):2097-2107.

    [Crossref] [Google Scholar] [PubMed]

19. Yang F, Silber S, Leu NA, Oates RD, Marszalek JD, Skaletsky H, et al. TEX11 is mutated in infertile men with azoospermia and regulates genome-wide recombination rates in mouse. EMBO Mol Med. 2015;7(9):1198-1210.

    [Crossref] [Google Scholar] [PubMed]

20. Offenberg HH, Schalk JA, Meuwissen RL, van Aalderen M, Kester HA, Dietrich AJ, et al. SCP2: a major protein component of the axial elements of synaptonemal complexes of the rat. Nucleic Acids Res. 1998;26(11):2572-2579.

    [Crossref] [Google Scholar] [PubMed]

21. Yang F, De La Fuente R, Leu NA, Baumann C, McLaughlin KJ, Wang PJ. Mouse SYCP2 is required for synaptonemal complex assembly and chromosomal synapsis during male meiosis. J Cell Biol. 2006;173(4):497-507.

    [Crossref] [Google Scholar] [PubMed]

22. Takemoto K, Imai Y, Saito K, Kawasaki T, Carlton PM, Ishiguro KI, et al. Sycp2 is essential for synaptonemal complex assembly, early meiotic recombination and homologous pairing in zebrafish spermatocytes. PLoS Genet. 2020;16(2):e1008640.

    [Crossref] [Google Scholar] [PubMed]

23. Schilit SLP, Menon S, Friedrich C, Kammin T, Wilch E, Hanscom C, et al. SYCP2 Translocation-Mediated Dysregulation and Frameshift Variants Cause Human Male Infertility. Am J Hum Genet. 2020;106(1):41-57.

    [Crossref] [Google Scholar] [PubMed]

24. Xu J, Sun Y, Zhang Y, Ou N, Bai H, Zhao J, et al. A homozygous frameshift variant in SYCP2 caused meiotic arrest and non-obstructive azoospermia. Clin Genet. 2023;104(5):577-581.

    [Crossref] [Google Scholar] [PubMed]

25. Zickler D, Kleckner N. Recombination, Pairing, and Synapsis of Homologs during Meiosis. Cold Spring Harb Perspect Biol. 2015;7(6):a016626.

    [Crossref] [Google Scholar] [PubMed]

26. Loidl J. Conservation and Variability of Meiosis Across the Eukaryotes. Annu Rev Genet. 2016;50:293-316.

    [Crossref] [Google Scholar] [PubMed]

27. Xie C, Wang W, Tu C, Meng L, Lu G, Lin G, et al. Meiotic recombination: insights into its mechanisms and its role in human reproduction with a special focus on non-obstructive azoospermia. Hum Reprod Update. 2022;28(6):763-797.

    [Crossref] [Google Scholar] [PubMed]

28. Winkel K, Alsheimer M, Ollinger R, Benavente R. Protein SYCP2 provides a link between transverse filaments and lateral elements of mammalian synaptonemal complexes. Chromosoma. 2009;118(2):259-267.

    [Crossref] [Google Scholar] [PubMed]

29. Börner GV, Hochwagen A, MacQueen AJ. Meiosis in budding yeast. Genetics. 2023;225(2):iyad125.

    [Crossref] [Google Scholar] [PubMed]

30. World Health Organization. WHO laboratory manual for the examination and processing of human semen. 5th ed, 2010. World Health Organization, Geneva, Switzerland.